ID: 1193553090

View in Genome Browser
Species Human (GRCh38)
Location X:82923317-82923339
Sequence GGGGGTTCCCTTTGCATAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193553082_1193553090 26 Left 1193553082 X:82923268-82923290 CCTTTCTGGCTTGTTGGGGTTTT No data
Right 1193553090 X:82923317-82923339 GGGGGTTCCCTTTGCATAACGGG No data
1193553087_1193553090 -7 Left 1193553087 X:82923301-82923323 CCACTGTTAACCTGATGGGGGTT No data
Right 1193553090 X:82923317-82923339 GGGGGTTCCCTTTGCATAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193553090 Original CRISPR GGGGGTTCCCTTTGCATAAC GGG Intergenic
No off target data available for this crispr