ID: 1193553930

View in Genome Browser
Species Human (GRCh38)
Location X:82931163-82931185
Sequence TTGGCCTAGCAAGAAACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193553930_1193553933 17 Left 1193553930 X:82931163-82931185 CCAGTGGTTTCTTGCTAGGCCAA No data
Right 1193553933 X:82931203-82931225 GATTAAGCATATAATCTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193553930 Original CRISPR TTGGCCTAGCAAGAAACCAC TGG (reversed) Intergenic
No off target data available for this crispr