ID: 1193555493

View in Genome Browser
Species Human (GRCh38)
Location X:82948932-82948954
Sequence CTCTTTGCAGAGATTGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193555493_1193555496 9 Left 1193555493 X:82948932-82948954 CCATTCACAATCTCTGCAAAGAG No data
Right 1193555496 X:82948964-82948986 CCTAGAAATATAGCTAACAAGGG 0: 6
1: 122
2: 832
3: 1888
4: 4705
1193555493_1193555494 8 Left 1193555493 X:82948932-82948954 CCATTCACAATCTCTGCAAAGAG No data
Right 1193555494 X:82948963-82948985 ACCTAGAAATATAGCTAACAAGG 0: 4
1: 117
2: 823
3: 1552
4: 3488
1193555493_1193555497 30 Left 1193555493 X:82948932-82948954 CCATTCACAATCTCTGCAAAGAG No data
Right 1193555497 X:82948985-82949007 GGATGTGAAAGACCTCTTCAAGG 0: 223
1: 9569
2: 6059
3: 3871
4: 2742

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193555493 Original CRISPR CTCTTTGCAGAGATTGTGAA TGG (reversed) Intergenic
No off target data available for this crispr