ID: 1193563132

View in Genome Browser
Species Human (GRCh38)
Location X:83044505-83044527
Sequence TTAGGTTTCCTGTTCTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193563129_1193563132 -5 Left 1193563129 X:83044487-83044509 CCATTTGTTCATTTTTGCTTAGG No data
Right 1193563132 X:83044505-83044527 TTAGGTTTCCTGTTCTTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193563132 Original CRISPR TTAGGTTTCCTGTTCTTGCA GGG Intergenic
No off target data available for this crispr