ID: 1193566024

View in Genome Browser
Species Human (GRCh38)
Location X:83078181-83078203
Sequence CAGCATAATTGGAATGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193566024_1193566028 -3 Left 1193566024 X:83078181-83078203 CCTGACTCATTCCAATTATGCTG No data
Right 1193566028 X:83078201-83078223 CTGGGTTCCCTCAGTGTTGTAGG No data
1193566024_1193566029 2 Left 1193566024 X:83078181-83078203 CCTGACTCATTCCAATTATGCTG No data
Right 1193566029 X:83078206-83078228 TTCCCTCAGTGTTGTAGGTAAGG No data
1193566024_1193566032 30 Left 1193566024 X:83078181-83078203 CCTGACTCATTCCAATTATGCTG No data
Right 1193566032 X:83078234-83078256 TAGAAGCAGTCCTTTTGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193566024 Original CRISPR CAGCATAATTGGAATGAGTC AGG (reversed) Intergenic
No off target data available for this crispr