ID: 1193566786

View in Genome Browser
Species Human (GRCh38)
Location X:83086435-83086457
Sequence TATCTCTGTGGGTGCAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193566782_1193566786 -1 Left 1193566782 X:83086413-83086435 CCAATGACAAAAACCATGTGATT 0: 20
1: 265
2: 2271
3: 8559
4: 3034
Right 1193566786 X:83086435-83086457 TATCTCTGTGGGTGCAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193566786 Original CRISPR TATCTCTGTGGGTGCAGAAA AGG Intergenic
No off target data available for this crispr