ID: 1193580056

View in Genome Browser
Species Human (GRCh38)
Location X:83252905-83252927
Sequence CTGGCTATTCATATCAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193580056_1193580065 25 Left 1193580056 X:83252905-83252927 CCCTGTCTGATATGAATAGCCAG No data
Right 1193580065 X:83252953-83252975 GAGATGGATTGCTTTCCTATTGG No data
1193580056_1193580062 2 Left 1193580056 X:83252905-83252927 CCCTGTCTGATATGAATAGCCAG No data
Right 1193580062 X:83252930-83252952 CACTGGGTCAGGAGTATGACTGG 0: 3
1: 8
2: 23
3: 48
4: 206
1193580056_1193580064 9 Left 1193580056 X:83252905-83252927 CCCTGTCTGATATGAATAGCCAG No data
Right 1193580064 X:83252937-83252959 TCAGGAGTATGACTGGGAGATGG No data
1193580056_1193580063 3 Left 1193580056 X:83252905-83252927 CCCTGTCTGATATGAATAGCCAG No data
Right 1193580063 X:83252931-83252953 ACTGGGTCAGGAGTATGACTGGG 0: 3
1: 10
2: 29
3: 37
4: 270
1193580056_1193580060 -9 Left 1193580056 X:83252905-83252927 CCCTGTCTGATATGAATAGCCAG No data
Right 1193580060 X:83252919-83252941 AATAGCCAGAACACTGGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193580056 Original CRISPR CTGGCTATTCATATCAGACA GGG (reversed) Intergenic
No off target data available for this crispr