ID: 1193580060

View in Genome Browser
Species Human (GRCh38)
Location X:83252919-83252941
Sequence AATAGCCAGAACACTGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193580056_1193580060 -9 Left 1193580056 X:83252905-83252927 CCCTGTCTGATATGAATAGCCAG No data
Right 1193580060 X:83252919-83252941 AATAGCCAGAACACTGGGTCAGG No data
1193580057_1193580060 -10 Left 1193580057 X:83252906-83252928 CCTGTCTGATATGAATAGCCAGA No data
Right 1193580060 X:83252919-83252941 AATAGCCAGAACACTGGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193580060 Original CRISPR AATAGCCAGAACACTGGGTC AGG Intergenic
No off target data available for this crispr