ID: 1193580062

View in Genome Browser
Species Human (GRCh38)
Location X:83252930-83252952
Sequence CACTGGGTCAGGAGTATGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 3, 1: 8, 2: 23, 3: 48, 4: 206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193580056_1193580062 2 Left 1193580056 X:83252905-83252927 CCCTGTCTGATATGAATAGCCAG No data
Right 1193580062 X:83252930-83252952 CACTGGGTCAGGAGTATGACTGG 0: 3
1: 8
2: 23
3: 48
4: 206
1193580057_1193580062 1 Left 1193580057 X:83252906-83252928 CCTGTCTGATATGAATAGCCAGA No data
Right 1193580062 X:83252930-83252952 CACTGGGTCAGGAGTATGACTGG 0: 3
1: 8
2: 23
3: 48
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193580062 Original CRISPR CACTGGGTCAGGAGTATGAC TGG Intergenic
900366561 1:2314158-2314180 CACTGGGTCAGGTTTAGGCCGGG + Intergenic
902139204 1:14338119-14338141 CACTGGGTCAGAAGAGAGACAGG - Intergenic
904266201 1:29319791-29319813 CCCTAGGTCAGGAGGAAGACTGG + Intronic
905641837 1:39595350-39595372 CACTGAGACAGGAGGATCACAGG + Intergenic
905979563 1:42211383-42211405 CATCTGGTCAGGAGTGTGACTGG + Intronic
909216271 1:72894160-72894182 CACTGGGTTAGAACTCTGACTGG - Intergenic
913155287 1:116091572-116091594 CACTGGGTCAGGTGTGTGTCTGG - Intergenic
915108790 1:153549976-153549998 CCCTGGGTCAGGAGTCAGGCTGG + Intronic
915263090 1:154693671-154693693 CAGTCAGTCAGGAGTATGAGAGG - Intergenic
915467288 1:156105047-156105069 CACTGGGGGAGGAGGATGAGAGG - Intronic
916078925 1:161219912-161219934 GACTGGGTCACGAGTAGGACTGG - Intronic
916620316 1:166489687-166489709 CCCTGAGTCAGGAGTGTGCCTGG + Intergenic
919491831 1:198213655-198213677 TACTGGGTTAGGAGTGTTACTGG + Intronic
920674984 1:208032316-208032338 CTCTGGGGCAGGAATAAGACTGG + Intronic
922294503 1:224237851-224237873 CACTGAGGCAGGAGAATCACTGG + Intronic
923066270 1:230520100-230520122 CACTAGGTTAGGAGGATGAGAGG + Intergenic
923241165 1:232087106-232087128 CAGTGGTGCAGAAGTATGACTGG + Intergenic
924099199 1:240585860-240585882 CACTGAGTTAAGAGTATGAAGGG + Intronic
1063105510 10:2988392-2988414 CACTGTGCCAGGAGCATGGCTGG - Intergenic
1065158254 10:22893314-22893336 CACTGGGTCAGGAGTGTGACTGG - Intergenic
1065355392 10:24835399-24835421 CACTGGGTCAGAAGTATGTCTGG + Intergenic
1065525264 10:26613779-26613801 GACTGGGGCAGGAGAATCACTGG + Intergenic
1065571370 10:27073487-27073509 CACCTGGTCAAGAGTGTGACTGG + Intronic
1065780325 10:29160988-29161010 AACTGGCTCAAGAGTATAACTGG + Intergenic
1067493215 10:46734042-46734064 CTCTGGTTCAGGAGTGTGGCTGG + Intergenic
1067596427 10:47562809-47562831 CAGTGGGTGAGGAGAATAACAGG + Intergenic
1067601445 10:47606364-47606386 CTCTGGTTCAGGAGTGTGGCTGG - Intergenic
1067987816 10:51170681-51170703 CTCTGAGTCAGGATTATGATTGG + Intronic
1068171894 10:53404725-53404747 CACCAGGTCAGGAGTGTGACTGG + Intergenic
1069275480 10:66586447-66586469 CACCAGGTCAGCAGTGTGACTGG - Intronic
1070041841 10:72788523-72788545 CTCTGAGTCAGGAGAATCACTGG + Intronic
1071616034 10:87077428-87077450 CAGTGGGTGAGGAGAATAACAGG - Intronic
1071652971 10:87413942-87413964 CTCTGGTTCAGGAGTGTGGCTGG - Intergenic
1072633999 10:97165688-97165710 CTCTGGGTCAGGAGGATGGGGGG + Intronic
1074299428 10:112219922-112219944 CACCAGGTCAGGAGAATGAAAGG + Intergenic
1074466821 10:113691114-113691136 CACTGGGTCAGGAGTGTGAATGG - Intronic
1075487831 10:122840403-122840425 CACTGGGACAGGCGTAAGAGGGG + Intronic
1075563057 10:123482378-123482400 CACAGGTTCTGGAGTCTGACAGG + Intergenic
1076043327 10:127270037-127270059 CACTGGGTCCTGTGTATGATTGG - Intronic
1078966794 11:16354408-16354430 CACTGGGTCACGAGTATATTGGG - Intronic
1079627479 11:22633753-22633775 CACTGGGTCAGGAGTGTGACTGG - Intronic
1079763045 11:24355497-24355519 AACTGGGTCAAGAGTGTGACTGG - Intergenic
1079974536 11:27075597-27075619 CACTGGGTCAGGAGTGTGACTGG - Intronic
1080978063 11:37365641-37365663 TGCTGGATCAGGAGTATGACTGG + Intergenic
1081550061 11:44102557-44102579 CACGGGGTCGGGGGTATGAGGGG + Intronic
1083476005 11:62916123-62916145 CACTGGATCAGGAGAAGGAGTGG - Intronic
1083698923 11:64461331-64461353 CACTGGGTCAGGGGATTGAAGGG + Intergenic
1083803916 11:65062483-65062505 CACTGAGTCAGGAGTGTGCCTGG - Intergenic
1084021780 11:66422079-66422101 TAGTGCGTCAGGAGTAAGACTGG - Intronic
1085281485 11:75333962-75333984 GACTGGGTCAGGAGTCTGGCTGG - Intronic
1086813329 11:91337032-91337054 TACTGGGTCAGGAGTGTTTCTGG + Intergenic
1087364427 11:97201280-97201302 CACTAAGTCAGGAGTGTGACTGG - Intergenic
1088552459 11:111026945-111026967 CACTGGATTAGGAGTGTGACTGG + Intergenic
1089108047 11:116031620-116031642 TCCTGGGTCAGGAGTCTAACTGG + Intergenic
1093266903 12:17015111-17015133 CACTGGGTCAAGAGAGTAACTGG - Intergenic
1094141163 12:27183109-27183131 CAGTTGCTCAGGAGTATGAATGG + Intergenic
1095786248 12:46111212-46111234 CATTGGGTCAAGGGTGTGACTGG + Intergenic
1097242133 12:57582782-57582804 CACTGAGGCAGGGGAATGACTGG - Intronic
1097906988 12:64930867-64930889 CACTGGGACAGGAGTGAGGCTGG - Intergenic
1099465494 12:82981717-82981739 CACTTGGTCGGGAATAGGACAGG - Intronic
1099468895 12:83022183-83022205 TTGTGAGTCAGGAGTATGACAGG - Intronic
1099526687 12:83725737-83725759 CACTGGGTCAGGGGTTTGCAAGG + Intergenic
1099834786 12:87895632-87895654 CACCAGGTTAGGAGGATGACAGG + Intergenic
1099934382 12:89108071-89108093 CAGTGGGTCAGAAGTATGGGAGG - Intergenic
1104261786 12:127190423-127190445 CTCTGGGTTGGGAATATGACTGG + Intergenic
1104704074 12:130929969-130929991 GGCTGAGGCAGGAGTATGACTGG + Intergenic
1104741422 12:131177606-131177628 CACTGTGTCAGGAGTATGACTGG + Intergenic
1108273110 13:48782651-48782673 CGCTGTGTCAGGAGTGTGACTGG - Intergenic
1109484046 13:62996114-62996136 CACTTGGTTAGGAGTATGTCTGG - Intergenic
1110788234 13:79559152-79559174 CACTGAGTCAGGAGTCAGAAGGG + Intergenic
1111823509 13:93242326-93242348 CACTGGGACAGGAGGATGATAGG - Intronic
1112158470 13:96843572-96843594 GACTGAGTCAGGAGAATCACTGG + Intergenic
1112369646 13:98783791-98783813 CACTGGATGAGGAGTCTGAGAGG - Intergenic
1113045810 13:106153273-106153295 GACTGGGGCAGGAGAAGGACAGG + Intergenic
1113215764 13:108039273-108039295 CACCGGGTTAGGAGGATGAGAGG + Intergenic
1113976851 13:114234420-114234442 CAATGGCTCAGGAGAAAGACAGG - Intergenic
1114261440 14:21039461-21039483 GACTGGTTCAGGAGTTTCACAGG - Intronic
1114365973 14:22027365-22027387 CACTGGGCCAGCAGTATGACTGG + Intergenic
1114698079 14:24646102-24646124 CACTGGGTCAGGAATGTGACTGG + Intergenic
1116274337 14:42811163-42811185 CACTGGGACAAGAGTGTGTCTGG - Intergenic
1117020710 14:51567445-51567467 GACTGTGGCAGGAGGATGACTGG - Intronic
1117316089 14:54572078-54572100 CACTGGGTCAGGAAAATAGCAGG - Intronic
1118886176 14:69867930-69867952 CACAGGGTTAGGATTATGAGAGG + Intronic
1122005202 14:98697741-98697763 CATGGGGTCAGGAGAGTGACAGG - Intergenic
1202847313 14_GL000009v2_random:191626-191648 CAGTTGGTCAGGAGTATGGGAGG - Intergenic
1202916777 14_GL000194v1_random:182183-182205 CAGTTGGTCAGGAGTATGGGAGG - Intergenic
1202876014 14_KI270722v1_random:1013-1035 CAGTTGGTCAGGAGTATGGGAGG + Intergenic
1124169476 15:27360071-27360093 CACTGGGTCAGGAGTGCTGCAGG + Intronic
1124613558 15:31225402-31225424 CACGAGGTCAGGAGTTTGAGAGG - Intergenic
1127369591 15:58326104-58326126 CTCTGGTCCAAGAGTATGACTGG + Intronic
1128941331 15:71790264-71790286 CACTGGGTCAGGAATGTGGTCGG + Intergenic
1129451205 15:75652277-75652299 CACTGGGGCAGGAGTAGGGCAGG + Intronic
1130083218 15:80753487-80753509 AAATGGGTCAGGAGTATGTCAGG + Intronic
1130605041 15:85308008-85308030 CACTGGATCAAGAGTTTGTCTGG + Intergenic
1133010937 16:2911596-2911618 CACGGGGTCAGGAAACTGACAGG + Intergenic
1136108790 16:28051676-28051698 CCCTGGGGCAGGAGCATGCCTGG + Intronic
1136527674 16:30842862-30842884 CACAAGGTCAGGAGAATGGCTGG - Intronic
1139170449 16:64625163-64625185 CACTGGGTCAGGAGTGTGACAGG - Intergenic
1144056810 17:11550554-11550576 CACTGGATATGGAGAATGACAGG + Intronic
1146372286 17:32272634-32272656 CACTGGGGCAGGAGTAAGGTAGG - Intronic
1147537985 17:41333352-41333374 CCCTGAGGCAGGAGCATGACCGG + Intergenic
1148610480 17:48961439-48961461 CACTGAGTCAGGAGAAGGGCAGG - Intronic
1149089770 17:52763746-52763768 CACTGGGTCAAGAGTATGTCTGG + Intergenic
1149693186 17:58595770-58595792 CTGTGGGTCAGGAATTTGACAGG - Intronic
1153268464 18:3295507-3295529 CAGTGTGCCAGGAGGATGACAGG + Intergenic
1155017629 18:21860936-21860958 AACTGAGGCAGGAGGATGACTGG + Intronic
1156131955 18:33987350-33987372 CACTTGATCACGAGAATGACTGG + Intronic
1159587876 18:70299258-70299280 CAGTCGGTCAGAAGTATGAGAGG - Intronic
1161391594 19:4024002-4024024 CACGGGGTCAGGGGCATGTCTGG - Intronic
1161431472 19:4234819-4234841 CACCGGGTGAGGAGGATGAGGGG + Exonic
1162240139 19:9345024-9345046 CAGTGGATCAGGAGAGTGACAGG - Intronic
1162440064 19:10687310-10687332 CAGTGGGTCAGGCGGAGGACGGG - Intronic
1162658894 19:12154299-12154321 CACTGAGGCAGGAGGATCACTGG - Intronic
1162760023 19:12883347-12883369 CACTAGGTTAGGAGGATGAGAGG + Intergenic
1162822753 19:13233164-13233186 CCCTGAGGCAGGAGTATGGCTGG - Intronic
1163194300 19:15703892-15703914 CACTGGGTCAGGAGTGTATCTGG + Intergenic
1166881345 19:45932137-45932159 CACTGAGGCAGGAGAATCACTGG - Intergenic
1167205336 19:48097690-48097712 GACTGGGGCAGGAGGATCACTGG - Intronic
1202674647 1_KI270710v1_random:31797-31819 CAGTTGGTCAGGAGTATGGGAGG - Intergenic
925637849 2:5959457-5959479 CACTAGGTTAGGAGTGTGACTGG - Intergenic
925998206 2:9308996-9309018 TCCTGGGGCAGGAGTATGACTGG - Intronic
926303820 2:11622816-11622838 CTCTGGGTCAGGACTCTGGCCGG + Intronic
927662061 2:25001579-25001601 CACTGGCTCAGAACAATGACGGG - Intergenic
928480081 2:31674825-31674847 CTCTGGGTCAAGAGTGTGCCTGG - Intergenic
928815585 2:35291671-35291693 CACTGGGTAGGGAGTATGACTGG - Intergenic
929804904 2:45136498-45136520 CACTGTGTGAGCAGTAAGACAGG - Intergenic
932215902 2:69965838-69965860 TACTGGGTGAGGAGTGTGGCAGG - Intergenic
932501962 2:72190271-72190293 TTCTGGGGCAGGAGTATCACTGG - Intronic
933349726 2:81137759-81137781 CACTGGGTCAGGAGTGTGTTTGG + Intergenic
934498863 2:94837208-94837230 GGCTGGGTCAGGGGCATGACTGG - Intergenic
936282825 2:111157600-111157622 CACCAGGTCTGGAGTCTGACAGG + Intronic
936815474 2:116455772-116455794 CACTGGGACAGAAGTATGTCTGG - Intergenic
936885690 2:117308325-117308347 CACTGAGTCAGGAGTGTGACTGG - Intergenic
937206207 2:120238696-120238718 CAGTGGGGCAGGAGGAGGACAGG + Intergenic
939305291 2:140402591-140402613 CACTGGGACAGGAGTGAGTCTGG + Intronic
939356411 2:141108923-141108945 CACCAGGTTAGGAGTATGATGGG + Intronic
942232967 2:173876990-173877012 CCCTGGGGCAGGAGTGTGCCTGG + Intergenic
942594994 2:177584233-177584255 CACTGGGGTAGGAGGATCACAGG + Intergenic
944370321 2:198974558-198974580 CACTGGGTTAGGGGTATGACTGG + Intergenic
946928123 2:224645707-224645729 CTCTGGGGCAGGAGAAAGACTGG + Intergenic
947386489 2:229595712-229595734 CCCTGGGGCAGGAGAGTGACTGG - Intronic
947592282 2:231392734-231392756 CACTGGGTCAGTGGCTTGACTGG - Intergenic
948361262 2:237422124-237422146 CAATGGGACAGGAGCTTGACGGG - Exonic
948621501 2:239237965-239237987 CCCTGGGTCAGGAGAAAGACCGG + Intronic
1169614304 20:7422132-7422154 CACAGTGTCAGGAATATCACAGG - Intergenic
1170108120 20:12774153-12774175 CACTGGACTTGGAGTATGACAGG - Intergenic
1170157071 20:13278707-13278729 CTGTGGGTCAGGAATTTGACTGG + Intronic
1170220446 20:13936343-13936365 CACCAGGTTAGGAGGATGACAGG + Intronic
1172788626 20:37487077-37487099 CACTGGGGCAGGAGGTTAACTGG - Intergenic
1174105186 20:48156900-48156922 CACTGGGTTAGAAGGATGAGAGG - Intergenic
1174420304 20:50395219-50395241 CACAGGCTCTGGAGTCTGACAGG - Intergenic
1175609679 20:60340234-60340256 CACTGAGACAGGAGTAATACAGG - Intergenic
1176637288 21:9258383-9258405 CAGTTGGTCAGGAGTATGGCAGG + Intergenic
1181540311 22:23569457-23569479 CACTGGGTCAGCAGTGAGGCAGG + Intergenic
1182464625 22:30506632-30506654 CCCTGGGTCAGCAGAATGTCTGG + Intergenic
1184394712 22:44226283-44226305 CCCTGGGGCAGGTGTATGCCTGG - Intergenic
953036539 3:39216569-39216591 TACTGGGTCAGGAGACTGAGTGG - Intergenic
953549231 3:43887890-43887912 CACTGGGTGACAAGGATGACAGG - Intergenic
954317687 3:49810196-49810218 CAGTGGGTCAGAAGTGGGACTGG + Intronic
954364078 3:50137173-50137195 CAGTGGGGCAGGTGTATGCCGGG - Intergenic
955429887 3:58831878-58831900 CTCTTGGTCAGGAATATGACTGG - Exonic
955802592 3:62701393-62701415 CACTGCTTCTGGACTATGACAGG + Intronic
956304019 3:67804654-67804676 CACTGGGACAGGGGTGTGAGAGG - Intergenic
956825465 3:72993730-72993752 CACTGGATAAGGTCTATGACGGG + Intronic
958171910 3:89948752-89948774 CACTGGGTCAGGAGTATGACTGG + Intergenic
959912731 3:111782052-111782074 TACTGTCTCAGGAATATGACAGG + Intronic
960460054 3:117922522-117922544 CACTGGGTGAGGAGTGTGATTGG - Intergenic
960753454 3:120982486-120982508 CCCTGGGACAGGGGTATAACAGG - Intronic
960782191 3:121331539-121331561 CACTGGGTGAAGAGTGTGTCTGG + Intronic
960791314 3:121434226-121434248 CACTAGGTCAGTAGGATGAAAGG - Intronic
962743183 3:138378136-138378158 CCCTGGGTGAGGAGTAAGAAGGG - Intronic
964564229 3:158032252-158032274 CACTGGGTCAGGATTATGTCTGG + Intergenic
966872696 3:184301637-184301659 CATGGGGTCATGAGTATGTCAGG + Exonic
967434898 3:189432115-189432137 CACTGGATCAGGAGTGTGACTGG + Intergenic
968124173 3:196146222-196146244 CACCGGGTTAGGGGGATGACAGG - Intergenic
1202749606 3_GL000221v1_random:146636-146658 CAGTTGGTCAGGAGTATGGCAGG - Intergenic
969278966 4:6156563-6156585 CCCTGGGTCACCAGGATGACTGG - Intronic
972311180 4:37885021-37885043 CCCTGGGGCAGGAGTGTGCCTGG + Intergenic
972773166 4:42217431-42217453 CACGGGGTCAGGAGTGACACAGG + Intergenic
973698256 4:53512462-53512484 CACTGGGTAGGGAGGAAGACTGG - Intronic
977510073 4:97952023-97952045 CAATGGGTCATGAGTGTGTCTGG - Intronic
978027626 4:103896916-103896938 CACTGGGTCAGGAGTGTGAATGG + Intergenic
980421348 4:132565393-132565415 CCCTGGAGAAGGAGTATGACAGG - Intergenic
981139640 4:141253646-141253668 CACAGGGTCAGGAGTGTGACTGG - Intergenic
981923730 4:150116032-150116054 CACTGGGTCAGGAATGTAACTGG - Intronic
982084488 4:151819726-151819748 CAGTGGGTCAGAAGTTCGACTGG + Intergenic
982187803 4:152820059-152820081 CACTGGGTCAAGAGTGTGATTGG + Intronic
983040189 4:162915562-162915584 CTCTGGTACAGGAGTGTGACAGG + Intergenic
985394699 4:189530191-189530213 CACTGGGTCAGAAGTGTGTCTGG - Intergenic
1202752179 4_GL000008v2_random:16810-16832 CAGTTGGTCAGGAGTATGACAGG + Intergenic
988260789 5:28883652-28883674 CACTGGGTCAGGAGTATGTCTGG + Intergenic
992217875 5:74543531-74543553 CCCTGGGTCTGGAGTGTGAGGGG - Intergenic
992702811 5:79358165-79358187 CACTGAGGCAGGAGAATCACTGG - Intergenic
993926740 5:93874676-93874698 CAGTTGGTCAGAAGTATGAGTGG + Intronic
994610047 5:102024619-102024641 CACAGGGTGAGGAGTATCACCGG + Intergenic
994908171 5:105867801-105867823 CACCAGGGCAGGAGTGTGACTGG - Intergenic
995115461 5:108473149-108473171 CACTGGGTCAGGAGTGTGACTGG + Intergenic
996112814 5:119585011-119585033 CACTGAGTCAGAAGTAAGACTGG - Intronic
997343457 5:133165864-133165886 CACAAGGTCAGGAGTTTGAGAGG - Intergenic
999416923 5:151406366-151406388 CACTGGCTCTGGAGCCTGACAGG - Intergenic
1002032691 5:176442203-176442225 CACAGAGTCAGGAGTGTGTCTGG - Intergenic
1004762985 6:18691274-18691296 CACTGGGTCTTGGGAATGACTGG + Intergenic
1005361584 6:25036138-25036160 CACTGAGTCAGGAGAATGGCCGG + Intronic
1005395342 6:25376959-25376981 CTCTGGGTCAGGAGTGTAATTGG - Intronic
1005974652 6:30788880-30788902 CACTGGTTCAGGGGAATCACTGG - Intergenic
1007697639 6:43743925-43743947 CACTGGTTAAGGAGTAAGAGCGG - Intergenic
1009614875 6:65991143-65991165 CACTGAGTAAGGAGTGTGATTGG + Intergenic
1010316709 6:74459749-74459771 TTCTGGGTAAGAAGTATGACTGG - Intergenic
1010456721 6:76064454-76064476 AGCTGGGCCAGGAATATGACAGG + Intronic
1012436395 6:99219617-99219639 CCCTGGCTCAGGATTATAACTGG - Intergenic
1015129713 6:129795497-129795519 CACAGGGGCAGGAGTGTGGCTGG - Intergenic
1015818059 6:137230635-137230657 CATTGGGTCAGGTATAAGACTGG + Intergenic
1016031733 6:139344838-139344860 CACTGGGTCAGGAGTGTGATTGG + Intergenic
1016498210 6:144689041-144689063 AACTGGGTCAGGAGAGTGACTGG - Intronic
1016775794 6:147903689-147903711 CACAAGGTCAGGAGTTTGAGAGG + Intergenic
1017043899 6:150329595-150329617 TTCTGGTTCAGGAGTATGACTGG - Intergenic
1018736165 6:166688548-166688570 CACTGGGTTTGGAGGATGAAAGG + Intronic
1019047693 6:169161185-169161207 CACAGGGTCAGGGGGAAGACAGG - Intergenic
1019859598 7:3645097-3645119 CACTTATTCACGAGTATGACAGG + Intronic
1020368919 7:7411873-7411895 CACAGTATCAGGAGAATGACGGG + Intronic
1020450343 7:8314765-8314787 CACCAGGTCAGGAGTATGACTGG - Intergenic
1020997504 7:15281515-15281537 CATTGGGTCAGGAGTGTGTCTGG + Intronic
1022311056 7:29195858-29195880 CACTGGTTTCTGAGTATGACAGG + Intronic
1023510264 7:40945280-40945302 CACTGGATCAGGAATGTGACTGG - Intergenic
1023608888 7:41954767-41954789 CAGTTGGTCAGAAGTATGAACGG + Intergenic
1024903718 7:54352230-54352252 CACTGGGTGGGGAGGACGACAGG + Intergenic
1025993184 7:66511497-66511519 GACTGTGACAGGAGTATGACAGG + Intergenic
1026036043 7:66831323-66831345 GACTGTGACAGGAGTATGACAGG - Intergenic
1026983460 7:74539819-74539841 GACTGTGACAGGAGTATGACAGG + Intronic
1027214556 7:76175421-76175443 GACTGTGACAGGAGTATGACAGG + Intergenic
1029158556 7:98534729-98534751 CCCTGGGGCAGGAGTGTGCCTGG + Intergenic
1030808578 7:113946483-113946505 CACTGGATCAGGAGTGGGACTGG + Intronic
1034557560 7:151859739-151859761 CACTGGGACAAGAGGATGGCTGG - Intronic
1037758957 8:21729365-21729387 CACTGGGACCTGAGTATTACAGG + Intronic
1038411371 8:27362143-27362165 AACTGGGTCAGCAAAATGACAGG - Intronic
1039075750 8:33689331-33689353 CCCTGGGCCAGGAACATGACAGG + Intergenic
1039088503 8:33803366-33803388 CACTGTGTCAGAAGTGTGATGGG + Intergenic
1039149491 8:34488064-34488086 TACTGAGTCAGAGGTATGACAGG - Intergenic
1039344401 8:36687963-36687985 AGCTGGGTCAGGAGTATGCGTGG - Intergenic
1039900915 8:41751992-41752014 CCCTGGGGCAGGAGTAAGAGTGG - Intronic
1042798172 8:72687425-72687447 CACTGGGGGAGAAGGATGACAGG - Intronic
1044224437 8:89703596-89703618 CACTTGGTCAGGAGTGTGTCTGG - Intergenic
1044880137 8:96715326-96715348 CACTGGGTCAGGAGTATGACTGG - Intronic
1046612084 8:116437249-116437271 CCCTGGGGCAGGAGTATAATTGG + Intergenic
1048505745 8:135019478-135019500 CACCAAGTTAGGAGTATGACAGG + Intergenic
1049741989 8:144245295-144245317 CTCTGGGTCATGAGTAACACAGG - Intronic
1049818598 8:144620710-144620732 CACTGGGTCAGGGGTCAGAGAGG - Intergenic
1050476285 9:6044865-6044887 CACTGGGTCAGGAGTTTGACTGG - Intergenic
1050668206 9:7965926-7965948 CCCTGAGTCAGGACTATGTCTGG - Intergenic
1051376765 9:16410077-16410099 CAATGGGTCTGGAGTAAGAAAGG + Exonic
1055141052 9:72877371-72877393 CACAGGGTTAGGATTATGAGAGG - Intergenic
1057340481 9:94197247-94197269 CACTGAGTCAGGAGTGTGTCTGG - Intergenic
1057667991 9:97061501-97061523 CACTGGGACAGGTGTGTGCCTGG + Intergenic
1058472105 9:105290439-105290461 CACTGATTCAGGAGAAAGACAGG + Intronic
1060487967 9:124061492-124061514 CACTTGGTCAGGCAGATGACTGG + Intergenic
1061274943 9:129564631-129564653 CTCAGGGGCAGGAGTATGAGAGG + Intergenic
1061276463 9:129571694-129571716 CACTGGGTCAGCAGTGAGGCAGG + Intergenic
1062212776 9:135373572-135373594 CACTGGGTCTGGACTATACCTGG - Intergenic
1062308534 9:135922997-135923019 CACGAGGTCAGGAGTTTGGCGGG - Intergenic
1203718248 Un_KI270742v1:176724-176746 CAGTTGGTCAGGAGTATGGCAGG - Intergenic
1203532965 Un_KI270743v1:1498-1520 CAGTTGGTCAGGAGTATGACAGG + Intergenic
1203652466 Un_KI270751v1:140417-140439 CAGTTGGTCAGGAGTATGGGAGG - Intergenic
1188956225 X:36437328-36437350 CACTGGGTCATGAGTATGTCTGG + Intergenic
1190011842 X:46791826-46791848 AACTGGGACAGGATTGTGACTGG + Intergenic
1191146968 X:57177267-57177289 CACTGAGTCAAGAGGATGATTGG - Intergenic
1191697200 X:64002469-64002491 CACTGGGTCAGGGGTCTGCAAGG - Intergenic
1192157020 X:68754239-68754261 CCCTGAGGCAGGAGTATGCCTGG - Intergenic
1192727132 X:73765341-73765363 CACTGTGTCAGGAGTGTGACTGG - Intergenic
1192886162 X:75336935-75336957 CACTGAGTCAGGAATGTGACTGG - Intergenic
1193300983 X:79887894-79887916 CACTGGGACAGGAGTGAGGCTGG + Intergenic
1193580062 X:83252930-83252952 CACTGGGTCAGGAGTATGACTGG + Intergenic
1193613399 X:83659386-83659408 CACTTGGTCAGAAGCATGAGAGG - Intergenic
1193995852 X:88365353-88365375 CACTGGGACAGGGGCATGATGGG + Intergenic
1194144079 X:90242048-90242070 CACTGGGTCAAGAGTATGTGTGG + Intergenic
1194182098 X:90724452-90724474 CACTGTGTCATGAGTATAATTGG + Intergenic
1194241730 X:91457495-91457517 CACTGTGTCAGGAAAGTGACTGG + Intergenic
1194614902 X:96088093-96088115 CACTGAGTCAGGAGGGTGACTGG + Intergenic
1194901876 X:99521408-99521430 CACTGGGTCAGGAGCGTGACTGG + Intergenic
1196789161 X:119448553-119448575 CCCTGGGACAGGAGCATGTCCGG - Intronic
1197009844 X:121546923-121546945 AACTGGGTCAGGAGTGTGACTGG + Intergenic
1197371292 X:125628742-125628764 CACTGGGTTAGGAGTGTGACTGG + Intergenic
1198698192 X:139366431-139366453 CAATAGGTCAGGAGTTTGACTGG - Intergenic
1199159021 X:144586230-144586252 TACTGGGTCAGGAGTGTGACTGG - Intergenic
1199170317 X:144727243-144727265 CACTGGGTCAGGAGTGAGTCTGG + Intergenic
1200489842 Y:3811349-3811371 CACTGGGTCAAGAGTATGTGTGG + Intergenic
1200528732 Y:4306405-4306427 CACTGTGTCATGAGTATAATTGG + Intergenic
1201172402 Y:11281574-11281596 CAGTTGGTCAGGAGTATGGGAGG - Intergenic
1201957170 Y:19638220-19638242 CACTGGGTTAGGAGTGTGACTGG - Intergenic