ID: 1193580063

View in Genome Browser
Species Human (GRCh38)
Location X:83252931-83252953
Sequence ACTGGGTCAGGAGTATGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 3, 1: 10, 2: 29, 3: 37, 4: 270}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193580056_1193580063 3 Left 1193580056 X:83252905-83252927 CCCTGTCTGATATGAATAGCCAG No data
Right 1193580063 X:83252931-83252953 ACTGGGTCAGGAGTATGACTGGG 0: 3
1: 10
2: 29
3: 37
4: 270
1193580057_1193580063 2 Left 1193580057 X:83252906-83252928 CCTGTCTGATATGAATAGCCAGA No data
Right 1193580063 X:83252931-83252953 ACTGGGTCAGGAGTATGACTGGG 0: 3
1: 10
2: 29
3: 37
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193580063 Original CRISPR ACTGGGTCAGGAGTATGACT GGG Intergenic
901295033 1:8154601-8154623 ACTGAGGCAGGAGGATCACTTGG - Intergenic
902057918 1:13617837-13617859 ACTGGGTCCAGTGTATGACTTGG - Exonic
903994089 1:27294478-27294500 ACTGGGACCCTAGTATGACTGGG + Intronic
904266203 1:29319792-29319814 CCTAGGTCAGGAGGAAGACTGGG + Intronic
905979564 1:42211384-42211406 ATCTGGTCAGGAGTGTGACTGGG + Intronic
907413356 1:54297733-54297755 ACTGGGTGAGGAGTCAGGCTTGG + Intronic
909227687 1:73045716-73045738 ACTGGGACAGGAGTGAGTCTTGG + Intergenic
909712835 1:78672441-78672463 ACTGGGTCAGGAGTACAAATAGG - Intergenic
909724325 1:78815827-78815849 CCTGGGGCAGGAGGATCACTTGG + Intergenic
909968820 1:81954241-81954263 ACTACTTCAGGAATATGACTAGG + Intronic
910165161 1:84319894-84319916 CCTGGGTCACCAGTAAGACTAGG - Intronic
910242452 1:85101965-85101987 GCTGAGGCAGGAGGATGACTTGG + Intronic
910661525 1:89678895-89678917 ACTGGGACAGGAGTAGGTTTTGG + Intronic
910888329 1:91990100-91990122 ACTGACCCAGGATTATGACTGGG + Intronic
911028299 1:93458362-93458384 GCTGGGGCAGGAGGATCACTTGG - Intronic
913155286 1:116091571-116091593 ACTGGGTCAGGTGTGTGTCTGGG - Intergenic
919491832 1:198213656-198213678 ACTGGGTTAGGAGTGTTACTGGG + Intronic
919689717 1:200518253-200518275 GCTGGGACAGGAGGATCACTTGG - Intergenic
920674985 1:208032317-208032339 TCTGGGGCAGGAATAAGACTGGG + Intronic
922447050 1:225706467-225706489 ACTGAGGCAGGAGGATCACTTGG + Intergenic
922737124 1:227992644-227992666 ACTGAGGCAGGAGAATCACTTGG + Intergenic
923585996 1:235271528-235271550 GCTGAGGCAGGAGTATCACTTGG + Intronic
923910147 1:238431991-238432013 ACTGGGTCAGGAGTGTGTCTTGG + Intergenic
924262446 1:242246131-242246153 ACTGAGTCAGGAGGATCACTTGG + Intronic
924751295 1:246894102-246894124 GCTGAGGCAGGAGGATGACTTGG + Intronic
1063105509 10:2988391-2988413 ACTGTGCCAGGAGCATGGCTGGG - Intergenic
1063587319 10:7364199-7364221 AGTGGGTAATCAGTATGACTTGG - Intronic
1065158253 10:22893313-22893335 ACTGGGTCAGGAGTGTGACTGGG - Intergenic
1065355393 10:24835400-24835422 ACTGGGTCAGAAGTATGTCTGGG + Intergenic
1065571371 10:27073488-27073510 ACCTGGTCAAGAGTGTGACTGGG + Intronic
1065712322 10:28530647-28530669 ACTGAGGCAGGAGAATCACTTGG - Intergenic
1066626311 10:37409431-37409453 ACTGAGGCAGGAGGATCACTTGG - Intergenic
1067493216 10:46734043-46734065 TCTGGTTCAGGAGTGTGGCTGGG + Intergenic
1067601444 10:47606363-47606385 TCTGGTTCAGGAGTGTGGCTGGG - Intergenic
1068171895 10:53404726-53404748 ACCAGGTCAGGAGTGTGACTGGG + Intergenic
1068789263 10:61009355-61009377 GCTGGGGCAGGAGAATCACTTGG - Intergenic
1069275479 10:66586446-66586468 ACCAGGTCAGCAGTGTGACTGGG - Intronic
1071307563 10:84312640-84312662 GCTGAGGCAGGAGTATCACTTGG + Intergenic
1073261016 10:102190420-102190442 GCTGGGGCAGGAGAATCACTTGG - Intergenic
1074466820 10:113691113-113691135 ACTGGGTCAGGAGTGTGAATGGG - Intronic
1074702673 10:116106210-116106232 ATAGGGTCAGAAGTCTGACTCGG - Intronic
1074730008 10:116361217-116361239 ACTGAGGCAGGTGTATCACTTGG - Intronic
1076924432 10:133475263-133475285 ACTGAGTGAGGAGTGTGGCTAGG - Intergenic
1077165739 11:1137134-1137156 CCTGGGTCAGGAATAAGAGTGGG + Intergenic
1077853415 11:6097287-6097309 ACTGGGTCAGGAGTGTGACCAGG + Intergenic
1079627478 11:22633752-22633774 ACTGGGTCAGGAGTGTGACTGGG - Intronic
1079893692 11:26091817-26091839 TCTGGATCAGGAGAAAGACTTGG + Intergenic
1079974535 11:27075596-27075618 ACTGGGTCAGGAGTGTGACTGGG - Intronic
1081271682 11:41092544-41092566 ACTGGCTCAAGAGAATGCCTAGG - Intronic
1083296803 11:61719379-61719401 GCAGGGTCAGGAGTAGGGCTTGG - Intronic
1083362108 11:62117090-62117112 ACTGAGACAGGAGGATCACTTGG - Intergenic
1083605395 11:63975678-63975700 ACTGAGGCAGGAGAATGGCTTGG - Intronic
1084021779 11:66422078-66422100 AGTGCGTCAGGAGTAAGACTGGG - Intronic
1086813330 11:91337033-91337055 ACTGGGTCAGGAGTGTTTCTGGG + Intergenic
1087364426 11:97201279-97201301 ACTAAGTCAGGAGTGTGACTGGG - Intergenic
1087489093 11:98800512-98800534 GCTGGGACAGGAGAATCACTTGG + Intergenic
1088552460 11:111026946-111026968 ACTGGATTAGGAGTGTGACTGGG + Intergenic
1088815270 11:113416599-113416621 AATGGTTCAGGGGTATGTCTGGG - Intronic
1089010477 11:115128113-115128135 ACTGAGACAGGAGCATGAATAGG + Intergenic
1089108049 11:116031621-116031643 CCTGGGTCAGGAGTCTAACTGGG + Intergenic
1090262946 11:125334696-125334718 ACTGAGGCAGGAGGATCACTTGG - Intronic
1091170758 11:133517913-133517935 AATGGGCAAGGAGGATGACTGGG + Intronic
1091379920 12:50761-50783 ACTGAGGCAGGAGAATGGCTTGG + Intergenic
1091661451 12:2386886-2386908 GCTGGGTCAGGTGGAGGACTGGG - Intronic
1092992692 12:13918303-13918325 ACTGAGGCAGGAGGATAACTTGG + Intronic
1093460359 12:19402343-19402365 GCTGGGTCAGAAGTGTAACTAGG - Intergenic
1093918605 12:24833918-24833940 ACTGAGACAGGAGGATCACTTGG - Intronic
1094244875 12:28277914-28277936 ACTGGGCCACTAGTATGACAAGG - Intronic
1094275113 12:28666165-28666187 GCTGGGTCTGAACTATGACTGGG - Intergenic
1094458203 12:30662776-30662798 ACTTGGTCATCAGAATGACTTGG + Intronic
1095086902 12:38066724-38066746 ACTGAGACAGGAGAATCACTTGG + Intergenic
1095205082 12:39430464-39430486 ACTGAGGCAGGAGAATCACTTGG + Intronic
1095786249 12:46111213-46111235 ATTGGGTCAAGGGTGTGACTGGG + Intergenic
1097918645 12:65047275-65047297 CCTGGCTCAGGGGCATGACTGGG - Intergenic
1099442755 12:82717737-82717759 AATGGGTCAGGAATTTTACTAGG + Intronic
1099534259 12:83826081-83826103 ACCAGGTCAGGAGTGTGACCAGG - Intergenic
1099785675 12:87260139-87260161 ACTATGTCAGGAGTTTTACTTGG - Intergenic
1100555765 12:95692133-95692155 GCTGGGGCAGGAGAATCACTTGG - Intronic
1101867816 12:108534987-108535009 AATGGGTCATGGTTATGACTGGG + Intronic
1102182233 12:110921259-110921281 GCTGGGACAGGAGGATCACTTGG + Intergenic
1103863660 12:124034230-124034252 ACTGGGTCTGGGGTAAGGCTTGG + Intronic
1104741423 12:131177607-131177629 ACTGTGTCAGGAGTATGACTGGG + Intergenic
1105529987 13:21210579-21210601 TCTGAGGCAGGAGAATGACTGGG + Intergenic
1107762843 13:43699283-43699305 TCTGGTTCAGGAGTCTGATTTGG + Intronic
1108273109 13:48782650-48782672 GCTGTGTCAGGAGTGTGACTGGG - Intergenic
1109421131 13:62114602-62114624 GCTGAGTCAGGAGAATCACTTGG - Intergenic
1109484045 13:62996113-62996135 ACTTGGTTAGGAGTATGTCTGGG - Intergenic
1110398351 13:75059464-75059486 GCTGAGTCAGGAGAATCACTAGG + Intergenic
1111823508 13:93242325-93242347 ACTGGGACAGGAGGATGATAGGG - Intronic
1112094166 13:96114249-96114271 ACTGAGGCAGGAGGATCACTTGG - Intronic
1113855015 13:113438756-113438778 ACTGAGCCAGGAGGATCACTTGG - Intronic
1114365974 14:22027366-22027388 ACTGGGCCAGCAGTATGACTGGG + Intergenic
1114698080 14:24646103-24646125 ACTGGGTCAGGAATGTGACTGGG + Intergenic
1115259099 14:31435109-31435131 GCTGAGGCAGGAGGATGACTTGG - Intronic
1116274336 14:42811162-42811184 ACTGGGACAAGAGTGTGTCTGGG - Intergenic
1118719513 14:68584137-68584159 ACTGTGTCAGGAGCATGAGACGG - Intronic
1120140014 14:80919485-80919507 AATGGGGCAGGAGTAGTACTGGG - Intronic
1122398692 14:101453858-101453880 GCTGGGTTTGGAGTATGGCTGGG - Intergenic
1122594669 14:102881282-102881304 ACTGAGACAGGAGAATCACTTGG + Intronic
1122868651 14:104623197-104623219 GCTGGGGCAGGAGAATCACTTGG - Intergenic
1123435428 15:20250834-20250856 ACTGAGGCAGGAGAATGGCTTGG - Intergenic
1125598011 15:40899793-40899815 ACTGGGTCAAGACGATGGCTAGG - Exonic
1125822988 15:42649657-42649679 GCTGGGGCAGGAGAATCACTTGG - Intronic
1127509401 15:59625208-59625230 ACTGAGGCAGGAGGATTACTTGG + Intronic
1129451206 15:75652278-75652300 ACTGGGGCAGGAGTAGGGCAGGG + Intronic
1130083219 15:80753488-80753510 AATGGGTCAGGAGTATGTCAGGG + Intronic
1130605042 15:85308009-85308031 ACTGGATCAAGAGTTTGTCTGGG + Intergenic
1133009537 16:2903328-2903350 ACTGAGGCAGGAGAATCACTTGG - Intergenic
1133757584 16:8774026-8774048 ACTGAGGCAGGAGAATCACTTGG - Intronic
1134888685 16:17818960-17818982 ATTGGCTTAGAAGTATGACTGGG - Intergenic
1136082562 16:27861716-27861738 CCTGGGTCAGGAATATGCTTTGG - Intronic
1136083099 16:27865795-27865817 GCTGAGGCAGGAGTATCACTTGG - Intronic
1136527673 16:30842861-30842883 ACAAGGTCAGGAGAATGGCTGGG - Intronic
1136849183 16:33600161-33600183 ACTGAGGCAGGAGAATGGCTTGG + Intergenic
1139170448 16:64625162-64625184 ACTGGGTCAGGAGTGTGACAGGG - Intergenic
1141132734 16:81446318-81446340 ACTGGGTCAGCTGGATGAGTCGG + Intronic
1141454468 16:84130858-84130880 AGTGGGTCTGGAGGAGGACTGGG + Intronic
1142191480 16:88720199-88720221 ACTGGATCAGCAGCATGACCAGG + Exonic
1203110890 16_KI270728v1_random:1448811-1448833 ACTGAGGCAGGAGAATGGCTTGG + Intergenic
1142679661 17:1539314-1539336 ACTGAGACAGGAGGATCACTCGG - Intronic
1144743340 17:17596625-17596647 ACTGAGTCAGGAGGATCGCTTGG - Intergenic
1144832130 17:18137690-18137712 ACAGGGACAGGAGTATTAATGGG - Intronic
1147452723 17:40515902-40515924 ACTGTGTCAAGAGGATGGCTTGG - Intergenic
1147707268 17:42434785-42434807 ACTGAGGCAGGAGAATCACTTGG + Intergenic
1148902800 17:50891194-50891216 ACTGCGCCAGGACTATGACCAGG - Intergenic
1149089771 17:52763747-52763769 ACTGGGTCAAGAGTATGTCTGGG + Intergenic
1149820335 17:59770812-59770834 ACTGAGGCAGGAGGATCACTAGG - Intronic
1151532732 17:74717461-74717483 ACTAGGTCAGGAGAGTAACTAGG + Intronic
1151604193 17:75125919-75125941 ACTGGGGCAGGAGTCTGCCAAGG - Intronic
1151905814 17:77048158-77048180 GCTGTGGCAGGAGGATGACTTGG - Intergenic
1153927926 18:9850764-9850786 ACTGAGGCAGGAGGATCACTTGG + Intronic
1154984647 18:21537433-21537455 ACTGGGGCAGGAGGGTCACTTGG + Intronic
1155017630 18:21860937-21860959 ACTGAGGCAGGAGGATGACTGGG + Intronic
1155346896 18:24866427-24866449 ACTGAGGCAGGAGAATCACTTGG - Intergenic
1157575884 18:48742754-48742776 ACTGGGTCCAGAGTCTGTCTGGG + Intronic
1157903469 18:51543348-51543370 ACTGAGGCAGGAGAATCACTTGG - Intergenic
1158918543 18:62163290-62163312 ACTGGGTCAGGTTTATTATTAGG - Intronic
1159414585 18:68127337-68127359 GCTGAGTCAGGAGAATCACTTGG + Intergenic
1163194301 19:15703893-15703915 ACTGGGTCAGGAGTGTATCTGGG + Intergenic
1164058689 19:21646019-21646041 ACTGACTCAGGAGAATCACTTGG - Intergenic
925637848 2:5959456-5959478 ACTAGGTTAGGAGTGTGACTGGG - Intergenic
925704982 2:6676081-6676103 ACTGGGCAAGCGGTATGACTTGG + Intergenic
927696718 2:25244418-25244440 ACCGGGTCTGGAGCATGGCTAGG + Intronic
928480080 2:31674824-31674846 TCTGGGTCAAGAGTGTGCCTGGG - Intergenic
928815584 2:35291670-35291692 ACTGGGTAGGGAGTATGACTGGG - Intergenic
931801330 2:65760859-65760881 ACAGGGTCAAGAGAATGAATGGG - Intergenic
933349727 2:81137760-81137782 ACTGGGTCAGGAGTGTGTTTGGG + Intergenic
933459800 2:82567735-82567757 GCTGAGACAGGAGCATGACTTGG - Intergenic
934543444 2:95195261-95195283 ACTGAGACAGGAGAATCACTTGG - Intergenic
934694375 2:96388587-96388609 ACTGAGGCAGGAGTATTGCTTGG - Intergenic
935056982 2:99576263-99576285 ACTGGGGCAGGTGAATCACTAGG - Intronic
935947297 2:108297863-108297885 GCTGGATCAGGAGTAGGAGTGGG + Intronic
936444548 2:112585577-112585599 TCTGGGTCTGAAGTAGGACTAGG - Intronic
936776747 2:115983974-115983996 ACCAGGTCAGGAGTGTGTCTTGG - Intergenic
936815473 2:116455771-116455793 ACTGGGACAGAAGTATGTCTGGG - Intergenic
936885689 2:117308324-117308346 ACTGAGTCAGGAGTGTGACTGGG - Intergenic
936986535 2:118316248-118316270 GCTGAGGCAGGAGGATGACTTGG - Intergenic
937812181 2:126211736-126211758 ACTGAGGCAGGAGGATTACTTGG + Intergenic
939305292 2:140402592-140402614 ACTGGGACAGGAGTGAGTCTGGG + Intronic
939631937 2:144536181-144536203 ACAGGGTCAGGAGTTTGAGCTGG - Intergenic
939648772 2:144736119-144736141 ACTGGCTCAGGGTAATGACTTGG + Intergenic
940863160 2:158790705-158790727 GCTGGGGCAGGAGGATCACTAGG - Intergenic
940970123 2:159887063-159887085 ACTGGGTCAGAAATATGTATAGG + Intronic
941725303 2:168853965-168853987 GCTGGGGCAGGAGAATCACTTGG - Intronic
942688272 2:178557273-178557295 ACTGGTTCAGAAGGATGGCTAGG + Exonic
943417400 2:187625624-187625646 ACTGAGGCAGGAGAATCACTTGG + Intergenic
943479005 2:188395222-188395244 ACTGAGTCAGTAGTGTAACTAGG - Intronic
944370322 2:198974559-198974581 ACTGGGTTAGGGGTATGACTGGG + Intergenic
945722774 2:213439131-213439153 CATGGGTCAGGAGTGTGAGTAGG - Intronic
946246267 2:218389451-218389473 GCTGGGGCAGGAGGATCACTTGG + Intronic
946874238 2:224111762-224111784 ACTGAGTCAGGAGTGTGACTCGG + Intergenic
947978949 2:234392467-234392489 GCTGAGTCAGGAGGATCACTTGG + Intergenic
1169668992 20:8073585-8073607 TGTGGGTCAGGAATCTGACTTGG - Intergenic
1170157072 20:13278708-13278730 TGTGGGTCAGGAATTTGACTGGG + Intronic
1172259182 20:33547292-33547314 GCTGAGTCGGGAGGATGACTTGG + Intronic
1172285851 20:33739962-33739984 ACTGAGGCAGGAGAATCACTTGG - Intronic
1172788625 20:37487076-37487098 ACTGGGGCAGGAGGTTAACTGGG - Intergenic
1172892149 20:38273228-38273250 TCTGAGTGAGGAGGATGACTTGG - Intronic
1173491193 20:43483618-43483640 GCTGAGGCAGGAGTATCACTTGG + Intergenic
1174369090 20:50074248-50074270 GCTGAGGCAGGAGAATGACTTGG - Intergenic
1176666327 21:9690759-9690781 CCTGGGTCATCAGAATGACTTGG - Intergenic
1176971309 21:15269035-15269057 ACTGAGGCAGGAGAATCACTTGG + Intergenic
1177890045 21:26794218-26794240 GCTGAGGCAGGAGAATGACTTGG - Intergenic
1179836890 21:44040848-44040870 ACTGAGGCAGGAGGATCACTTGG - Intronic
1179980396 21:44892518-44892540 GCTGAGTCAGGAGAATCACTTGG + Intronic
1181528557 22:23503108-23503130 ACTGAGACAGGAGAATGAGTTGG + Intergenic
1182639721 22:31757246-31757268 GCTGGGACAGGAGGATCACTTGG + Intronic
1183910121 22:41072724-41072746 ACTGGGGCAGGAGTATAAATTGG + Intergenic
950355001 3:12399766-12399788 ACTGAGGCAGGAGGATCACTTGG + Intronic
950497839 3:13344870-13344892 CCTGGGCCTGGAGGATGACTTGG - Intronic
954208814 3:49081905-49081927 ACTGAGGCAGGAGAATGGCTGGG - Intronic
954255475 3:49402572-49402594 GCTGAGGCAGGAGTATTACTTGG + Intronic
954366751 3:50150525-50150547 GCTGGGTCAGGAGCTTCACTGGG - Intergenic
955308017 3:57853839-57853861 GCTGAGGCAGGAGAATGACTTGG + Intronic
957761682 3:84566670-84566692 ACTGAGGCAGGAGAATCACTTGG + Intergenic
957805570 3:85144147-85144169 AGTGGGTCAGGAGTATGGTCTGG - Intronic
958171911 3:89948753-89948775 ACTGGGTCAGGAGTATGACTGGG + Intergenic
958530858 3:95328963-95328985 ACTGGGTCAAGAATGTGTCTAGG - Intergenic
959006424 3:101025736-101025758 ACTGGGTAAGGGGTGTAACTGGG - Intergenic
960460053 3:117922521-117922543 ACTGGGTGAGGAGTGTGATTGGG - Intergenic
960782192 3:121331540-121331562 ACTGGGTGAAGAGTGTGTCTGGG + Intronic
961628239 3:128278451-128278473 ACAGAGCCAGGAGTATGGCTTGG + Intronic
964465339 3:156985622-156985644 TTTAGGCCAGGAGTATGACTTGG + Intronic
964564230 3:158032253-158032275 ACTGGGTCAGGATTATGTCTGGG + Intergenic
964858589 3:161174269-161174291 ACTGAGGCAGGAGGATCACTTGG - Intronic
967434899 3:189432116-189432138 ACTGGATCAGGAGTGTGACTGGG + Intergenic
967722752 3:192832688-192832710 GCTGGGGCAGGAGAATCACTTGG + Intronic
967737915 3:192972944-192972966 AATGGGTAAAGAGTATGACATGG + Intergenic
967738201 3:192976158-192976180 GCTGAGGCAGGAGTATCACTTGG + Intergenic
968291276 3:197541696-197541718 TCTGGGTCAGGAGTGAGGCTAGG - Intronic
968309157 3:197668455-197668477 GCTGGGGCAGGAGTAAGAGTAGG - Intergenic
969278964 4:6156562-6156584 CCTGGGTCACCAGGATGACTGGG - Intronic
970120506 4:12747957-12747979 GCTGAGGCAGGAGAATGACTTGG - Intergenic
970592481 4:17571490-17571512 TCTGGGTCAGGAGAATGTGTGGG - Intergenic
971416506 4:26436740-26436762 AAGGGGTAAGGAGTGTGACTAGG + Intergenic
971721837 4:30255311-30255333 TCTGGGTCAGGAGTATGACTAGG - Intergenic
972075071 4:35077813-35077835 ACTGGGTGAGCAGTATGTGTGGG + Intergenic
972213080 4:36862171-36862193 ACTGGGATAGGAGCATGAATTGG - Intergenic
972635088 4:40877182-40877204 ATGGGGTCAGGAGTCTGTCTTGG + Intronic
974856446 4:67466583-67466605 ACTGGGTCAGCAGTGTGACTAGG + Intergenic
975290858 4:72677268-72677290 ACTGGGTAAGCAGTGTGTCTGGG - Intergenic
976771785 4:88660856-88660878 AATTGGTCTGGAGTATGACTTGG + Intronic
978027627 4:103896917-103896939 ACTGGGTCAGGAGTGTGAATGGG + Intergenic
978180288 4:105786410-105786432 ACTGAGTCAGGAGAATCGCTTGG + Intronic
979130694 4:117040969-117040991 ACTGTGTGAGGTCTATGACTGGG + Intergenic
981139639 4:141253645-141253667 ACAGGGTCAGGAGTGTGACTGGG - Intergenic
981923729 4:150116031-150116053 ACTGGGTCAGGAATGTAACTGGG - Intronic
982066522 4:151659264-151659286 AGTGGGGGAAGAGTATGACTTGG - Intronic
982187804 4:152820060-152820082 ACTGGGTCAAGAGTGTGATTGGG + Intronic
984947741 4:184983118-184983140 ACTGGGTCAGAAATAAGATTTGG + Intergenic
985267263 4:188161723-188161745 GCTGAGGCAGGAGTATTACTTGG + Intergenic
985394698 4:189530190-189530212 ACTGGGTCAGAAGTGTGTCTGGG - Intergenic
985408693 4:189661578-189661600 CCTGGGTCATCAGAATGACTTGG + Intergenic
987969106 5:24919115-24919137 ATAAGTTCAGGAGTATGACTAGG - Intergenic
988260790 5:28883653-28883675 ACTGGGTCAGGAGTATGTCTGGG + Intergenic
989109522 5:37893752-37893774 ACTGGCTAAGGATTTTGACTTGG + Intergenic
991645691 5:68798602-68798624 ACTGAGGCAGGAGAATCACTTGG + Intergenic
994610048 5:102024620-102024642 ACAGGGTGAGGAGTATCACCGGG + Intergenic
994908170 5:105867800-105867822 ACCAGGGCAGGAGTGTGACTGGG - Intergenic
995115462 5:108473150-108473172 ACTGGGTCAGGAGTGTGACTGGG + Intergenic
995977886 5:118063744-118063766 ACTGAGGCAGGAGAATCACTTGG - Intergenic
996112813 5:119585010-119585032 ACTGAGTCAGAAGTAAGACTGGG - Intronic
1001865772 5:175104106-175104128 AATGGGTCTGGAGGATGAGTAGG + Intergenic
1002539575 5:179897410-179897432 ACTGAGGCAGGAGAATCACTTGG - Intronic
1002636237 5:180610131-180610153 CCTGGGGCAGGAGTATGGATGGG + Intronic
1003402021 6:5798308-5798330 TCTGAGGCAGGAGAATGACTGGG - Intergenic
1003463940 6:6359177-6359199 AGTGGATCAGGTATATGACTTGG - Intergenic
1004111651 6:12724225-12724247 ACTGAGGCAGGAGAATCACTTGG + Intronic
1004121124 6:12822943-12822965 TCTGGGTCAGGGATATGAGTGGG + Intronic
1006542463 6:34751650-34751672 ACTGGGGCAGGAGAATCACTTGG - Intergenic
1007520326 6:42446903-42446925 GCTGGGGCAGGAGGATCACTTGG + Intronic
1009624726 6:66125483-66125505 ACTGGGTCGGGAGTGTGACTAGG - Intergenic
1010456722 6:76064455-76064477 GCTGGGCCAGGAATATGACAGGG + Intronic
1011910420 6:92429493-92429515 AAAGGGTAAGGAGTATGTCTTGG + Intergenic
1012436393 6:99219616-99219638 CCTGGCTCAGGATTATAACTGGG - Intergenic
1012552891 6:100480683-100480705 ACTGAGGCAGGAGGATCACTTGG - Intergenic
1012916973 6:105180489-105180511 GCTGAGTCAGGAGGATGCCTGGG - Intergenic
1013495137 6:110690335-110690357 ACTGGGTCAGAAGTGGGTCTAGG + Intronic
1015588184 6:134797280-134797302 ACTGAGGCAGGAGGATCACTTGG + Intergenic
1016031734 6:139344839-139344861 ACTGGGTCAGGAGTGTGATTGGG + Intergenic
1016498209 6:144689040-144689062 ACTGGGTCAGGAGAGTGACTGGG - Intronic
1017168480 6:151432819-151432841 CCTGGGGCAGGAGTCTGACAAGG + Intronic
1017198447 6:151727299-151727321 ACTGAGGCAGGAGAATCACTTGG - Intronic
1020997505 7:15281516-15281538 ATTGGGTCAGGAGTGTGTCTGGG + Intronic
1020997507 7:15281533-15281555 TCTGGGTCAGGAGTGTGTCTAGG + Intronic
1021568248 7:22036294-22036316 ACTGAGGCAGGAGAATCACTTGG - Intergenic
1021769634 7:23985377-23985399 AGTGGGTCAGGAGTGTGACTTGG + Intergenic
1023510263 7:40945279-40945301 ACTGGATCAGGAATGTGACTGGG - Intergenic
1023784493 7:43692727-43692749 AAAGAGTCATGAGTATGACTAGG + Intronic
1024220367 7:47282162-47282184 ACAGGGTCAGGGGCATGGCTCGG - Intronic
1024637233 7:51300923-51300945 ACTGGGTCAGGAGTGTGCACTGG + Intronic
1026106091 7:67421930-67421952 GCTGAGGCAGGAGTATCACTTGG + Intergenic
1026638384 7:72104042-72104064 ACTGGGCCAGGATTAAGTCTAGG + Intronic
1026698167 7:72614396-72614418 ACTGAGACAGGCGTATCACTTGG + Intronic
1027269338 7:76511511-76511533 ACTGGGTCTGGACTATCTCTGGG + Intronic
1027320049 7:77005406-77005428 ACTGGGTCTGGACTATCTCTGGG + Intergenic
1027838535 7:83278276-83278298 ATTGGGTCAGAAGTGTGTCTAGG - Intergenic
1028411591 7:90536254-90536276 ACTGAGGCAGGAGGATTACTTGG + Intronic
1029340504 7:99940111-99940133 GCTGGGGCAGGAGAATCACTTGG - Intergenic
1030033710 7:105390526-105390548 ACTGAGGCAGGAGAATGGCTTGG - Intronic
1030095973 7:105900209-105900231 ACTGGGTCAGGAGTGTGACTAGG + Intronic
1030498725 7:110332544-110332566 ACTGAGGCAGGAGGATCACTTGG - Intergenic
1030808579 7:113946484-113946506 ACTGGATCAGGAGTGGGACTGGG + Intronic
1032850029 7:135786453-135786475 GCTGGGGCAGGAGAATCACTTGG - Intergenic
1033492170 7:141854370-141854392 ACTGGGTCAGGAGTGTATCTAGG - Intergenic
1037920823 8:22804229-22804251 GCTGAGGCAGGAGGATGACTTGG + Intronic
1038113028 8:24521303-24521325 ACAGGGTCAGCAGTATACCTTGG + Intronic
1039162042 8:34632429-34632451 ATAAGGTTAGGAGTATGACTGGG - Intergenic
1039344400 8:36687962-36687984 GCTGGGTCAGGAGTATGCGTGGG - Intergenic
1039578019 8:38641109-38641131 CCTTGGAAAGGAGTATGACTGGG - Intergenic
1039703039 8:39980847-39980869 ACTGAGTCAGGAGAATCCCTTGG - Intronic
1039806210 8:41001886-41001908 GCTGAGGCAGGAGTATCACTTGG - Intergenic
1039832125 8:41223742-41223764 TCTGGGGCAGGAGGATGCCTGGG + Intergenic
1039903740 8:41771293-41771315 ACTGGGTAAGCTGTACGACTTGG + Intronic
1040356678 8:46625217-46625239 ACTGAGGCAGGAGGATCACTTGG - Intergenic
1041640392 8:60193546-60193568 ACTGGGTTAAAAGTTTGACTAGG + Intronic
1044204811 8:89480819-89480841 AATGCATCAGGAGTATGATTTGG + Intergenic
1044224436 8:89703595-89703617 ACTTGGTCAGGAGTGTGTCTGGG - Intergenic
1044338587 8:91019671-91019693 ACTGAGGCAGGAGTATCATTTGG - Intronic
1044880136 8:96715325-96715347 ACTGGGTCAGGAGTATGACTGGG - Intronic
1045513422 8:102833667-102833689 GCTGGGGCAGGAGGATCACTTGG + Intronic
1045563413 8:103288550-103288572 GCTGAGGCAGGAGGATGACTTGG - Intergenic
1047384193 8:124394553-124394575 ACTGGGTCAGGAGTGTAACTAGG - Intergenic
1047920784 8:129632353-129632375 ACTGAGGCAGGAGGATCACTTGG + Intergenic
1048418694 8:134255274-134255296 GCTGAGTCAGGAGGATGGCTTGG - Intergenic
1049663515 8:143831379-143831401 GCTGAGGCAGGAGTATCACTTGG + Intergenic
1050166457 9:2769769-2769791 ACTGAGGCAGGAGGATCACTTGG - Intronic
1050920880 9:11199147-11199169 AATGGGTCAGGAATAAGAATTGG - Intergenic
1051010128 9:12401895-12401917 ACTGGGCAAGTAGTATTACTTGG + Intergenic
1052933907 9:34077478-34077500 GCTGGGGCAGGAGGATGGCTTGG + Intergenic
1053607170 9:39672285-39672307 ACTGAGGCAGGAGAATGGCTCGG - Intergenic
1054246364 9:62670124-62670146 ACTGAGGCAGGAGAATGGCTCGG + Intergenic
1054358990 9:64094284-64094306 GCTGGGTCAGGGGCATGATTAGG + Intergenic
1054560485 9:66704657-66704679 ACTGAGGCAGGAGAATGGCTCGG + Intergenic
1054699943 9:68403433-68403455 ACTGGGGGAGGAGGATGATTTGG - Intronic
1055331651 9:75190133-75190155 ACTGGGGCAGGAGAATCGCTTGG + Intergenic
1056418802 9:86403754-86403776 AGTGGGTTAAGAGTATGAGTGGG - Intergenic
1057340480 9:94197246-94197268 ACTGAGTCAGGAGTGTGTCTGGG - Intergenic
1058715318 9:107717527-107717549 ACTGGCTCAGAAGGATGAGTTGG + Intergenic
1059834040 9:118129773-118129795 ACTGGGTCAGGAGTGTGACAAGG + Intergenic
1060447957 9:123709249-123709271 CCTGGGTCGGGAGTAGGATTGGG - Intronic
1060865420 9:126991307-126991329 ACTGGGGCAGGAGTCTGAACTGG + Intronic
1061351387 9:130067842-130067864 GCTGGGGCAGGAGGATCACTTGG - Intronic
1061465790 9:130778457-130778479 AGTGGGTCAGGCGTGTGCCTTGG + Intronic
1062212775 9:135373571-135373593 ACTGGGTCTGGACTATACCTGGG - Intergenic
1203659774 Un_KI270753v1:31002-31024 CCTGGGTCATCAGAATGACTTGG + Intergenic
1185480026 X:439059-439081 GCTGAGGCAGGAGAATGACTTGG - Intergenic
1185907412 X:3948752-3948774 ACTGGGTGAGAAGCATAACTAGG + Intergenic
1187249137 X:17581281-17581303 ACTGGGCCACGTCTATGACTGGG + Intronic
1188480803 X:30635296-30635318 ACTGAGTCTGGAGGATCACTAGG - Intergenic
1188956226 X:36437329-36437351 ACTGGGTCATGAGTATGTCTGGG + Intergenic
1189296332 X:39920888-39920910 GCTGAGGCAGGAGAATGACTTGG + Intergenic
1189342503 X:40215117-40215139 ACTGGGGCAGTAGGATCACTGGG + Intergenic
1191146967 X:57177266-57177288 ACTGAGTCAAGAGGATGATTGGG - Intergenic
1192682709 X:73268301-73268323 ACTGGGTCAAGAGTGTGACTAGG + Intergenic
1192682773 X:73268775-73268797 ACTGTGACAGGAGTGTAACTGGG + Intergenic
1192727131 X:73765340-73765362 ACTGTGTCAGGAGTGTGACTGGG - Intergenic
1192905451 X:75546133-75546155 ACTGGGTCAGGACTGTGACTTGG - Intergenic
1193300984 X:79887895-79887917 ACTGGGACAGGAGTGAGGCTGGG + Intergenic
1193580063 X:83252931-83252953 ACTGGGTCAGGAGTATGACTGGG + Intergenic
1194144080 X:90242049-90242071 ACTGGGTCAAGAGTATGTGTGGG + Intergenic
1194469663 X:94277389-94277411 TCTAGGTCAGGAGTAATACTGGG - Intergenic
1197009845 X:121546924-121546946 ACTGGGTCAGGAGTGTGACTGGG + Intergenic
1197371293 X:125628743-125628765 ACTGGGTTAGGAGTGTGACTGGG + Intergenic
1198811286 X:140538800-140538822 ACTTGGACAGGAAGATGACTTGG + Intergenic
1199159020 X:144586229-144586251 ACTGGGTCAGGAGTGTGACTGGG - Intergenic
1199546628 X:149013217-149013239 ACTGTGACAAGAGGATGACTGGG + Intergenic
1200489843 Y:3811350-3811372 ACTGGGTCAAGAGTATGTGTGGG + Intergenic
1201957169 Y:19638219-19638241 ACTGGGTTAGGAGTGTGACTGGG - Intergenic