ID: 1193580065

View in Genome Browser
Species Human (GRCh38)
Location X:83252953-83252975
Sequence GAGATGGATTGCTTTCCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193580057_1193580065 24 Left 1193580057 X:83252906-83252928 CCTGTCTGATATGAATAGCCAGA No data
Right 1193580065 X:83252953-83252975 GAGATGGATTGCTTTCCTATTGG No data
1193580061_1193580065 6 Left 1193580061 X:83252924-83252946 CCAGAACACTGGGTCAGGAGTAT No data
Right 1193580065 X:83252953-83252975 GAGATGGATTGCTTTCCTATTGG No data
1193580056_1193580065 25 Left 1193580056 X:83252905-83252927 CCCTGTCTGATATGAATAGCCAG No data
Right 1193580065 X:83252953-83252975 GAGATGGATTGCTTTCCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193580065 Original CRISPR GAGATGGATTGCTTTCCTAT TGG Intergenic
No off target data available for this crispr