ID: 1193582538

View in Genome Browser
Species Human (GRCh38)
Location X:83283588-83283610
Sequence TCTCTGAGTAGACCAATAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193582538_1193582542 8 Left 1193582538 X:83283588-83283610 CCTGCTATTGGTCTACTCAGAGA No data
Right 1193582542 X:83283619-83283641 CTTCCTGGTTTAGTATTGGGAGG 0: 32
1: 5094
2: 3341
3: 2077
4: 1964
1193582538_1193582540 4 Left 1193582538 X:83283588-83283610 CCTGCTATTGGTCTACTCAGAGA No data
Right 1193582540 X:83283615-83283637 ACTTCTTCCTGGTTTAGTATTGG 0: 38
1: 8084
2: 3969
3: 2105
4: 2282
1193582538_1193582541 5 Left 1193582538 X:83283588-83283610 CCTGCTATTGGTCTACTCAGAGA No data
Right 1193582541 X:83283616-83283638 CTTCTTCCTGGTTTAGTATTGGG 0: 41
1: 8448
2: 3739
3: 1863
4: 1602
1193582538_1193582543 9 Left 1193582538 X:83283588-83283610 CCTGCTATTGGTCTACTCAGAGA No data
Right 1193582543 X:83283620-83283642 TTCCTGGTTTAGTATTGGGAGGG 0: 29
1: 4913
2: 3152
3: 1715
4: 958
1193582538_1193582545 23 Left 1193582538 X:83283588-83283610 CCTGCTATTGGTCTACTCAGAGA No data
Right 1193582545 X:83283634-83283656 TTGGGAGGGTGTATGTGTCCAGG 0: 2577
1: 4507
2: 5489
3: 3080
4: 2288
1193582538_1193582539 -7 Left 1193582538 X:83283588-83283610 CCTGCTATTGGTCTACTCAGAGA No data
Right 1193582539 X:83283604-83283626 TCAGAGATTCAACTTCTTCCTGG 0: 5800
1: 3527
2: 2396
3: 2146
4: 1885

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193582538 Original CRISPR TCTCTGAGTAGACCAATAGC AGG (reversed) Intergenic
No off target data available for this crispr