ID: 1193582849

View in Genome Browser
Species Human (GRCh38)
Location X:83286457-83286479
Sequence ACCCTGCTTCAGCTCATGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193582849_1193582855 9 Left 1193582849 X:83286457-83286479 CCGTGCATGAGCTGAAGCAGGGT No data
Right 1193582855 X:83286489-83286511 CCTCACCTGGGAAGAACAAAGGG No data
1193582849_1193582851 -4 Left 1193582849 X:83286457-83286479 CCGTGCATGAGCTGAAGCAGGGT No data
Right 1193582851 X:83286476-83286498 GGGTGAGGCATCGCCTCACCTGG No data
1193582849_1193582852 -3 Left 1193582849 X:83286457-83286479 CCGTGCATGAGCTGAAGCAGGGT No data
Right 1193582852 X:83286477-83286499 GGTGAGGCATCGCCTCACCTGGG No data
1193582849_1193582858 15 Left 1193582849 X:83286457-83286479 CCGTGCATGAGCTGAAGCAGGGT No data
Right 1193582858 X:83286495-83286517 CTGGGAAGAACAAAGGGTCAGGG No data
1193582849_1193582857 14 Left 1193582849 X:83286457-83286479 CCGTGCATGAGCTGAAGCAGGGT No data
Right 1193582857 X:83286494-83286516 CCTGGGAAGAACAAAGGGTCAGG No data
1193582849_1193582853 8 Left 1193582849 X:83286457-83286479 CCGTGCATGAGCTGAAGCAGGGT No data
Right 1193582853 X:83286488-83286510 GCCTCACCTGGGAAGAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193582849 Original CRISPR ACCCTGCTTCAGCTCATGCA CGG (reversed) Intergenic