ID: 1193582857

View in Genome Browser
Species Human (GRCh38)
Location X:83286494-83286516
Sequence CCTGGGAAGAACAAAGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4647
Summary {0: 2, 1: 14, 2: 314, 3: 1706, 4: 2611}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193582849_1193582857 14 Left 1193582849 X:83286457-83286479 CCGTGCATGAGCTGAAGCAGGGT No data
Right 1193582857 X:83286494-83286516 CCTGGGAAGAACAAAGGGTCAGG 0: 2
1: 14
2: 314
3: 1706
4: 2611

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193582857 Original CRISPR CCTGGGAAGAACAAAGGGTC AGG Intergenic