ID: 1193584713

View in Genome Browser
Species Human (GRCh38)
Location X:83306787-83306809
Sequence CTATGTCACCAGAAGCAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193584711_1193584713 24 Left 1193584711 X:83306740-83306762 CCTCAGGTAATTCTGTTACATAC No data
Right 1193584713 X:83306787-83306809 CTATGTCACCAGAAGCAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193584713 Original CRISPR CTATGTCACCAGAAGCAGAA TGG Intergenic
No off target data available for this crispr