ID: 1193586058

View in Genome Browser
Species Human (GRCh38)
Location X:83322917-83322939
Sequence ACATAGAAAGTGTTCTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193586054_1193586058 -5 Left 1193586054 X:83322899-83322921 CCTAGTATAGAGCCAGGCACATA No data
Right 1193586058 X:83322917-83322939 ACATAGAAAGTGTTCTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193586058 Original CRISPR ACATAGAAAGTGTTCTGGGA AGG Intergenic
No off target data available for this crispr