ID: 1193586792

View in Genome Browser
Species Human (GRCh38)
Location X:83332142-83332164
Sequence CTGGCACAACTTGTTTAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193586792_1193586798 28 Left 1193586792 X:83332142-83332164 CCTCCTTAAACAAGTTGTGCCAG No data
Right 1193586798 X:83332193-83332215 TCCTCTAAATTATAAAATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193586792 Original CRISPR CTGGCACAACTTGTTTAAGG AGG (reversed) Intergenic
No off target data available for this crispr