ID: 1193587780

View in Genome Browser
Species Human (GRCh38)
Location X:83347396-83347418
Sequence AAGGCTGGACAGTTTTTCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193587775_1193587780 23 Left 1193587775 X:83347350-83347372 CCAAATAAAAGAAAAATGAGTAA No data
Right 1193587780 X:83347396-83347418 AAGGCTGGACAGTTTTTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193587780 Original CRISPR AAGGCTGGACAGTTTTTCCT AGG Intergenic
No off target data available for this crispr