ID: 1193593545

View in Genome Browser
Species Human (GRCh38)
Location X:83419394-83419416
Sequence CATTGCAGGCAGAGCCTTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193593539_1193593545 -5 Left 1193593539 X:83419376-83419398 CCTCTCCTTGCCAACCACCATTG No data
Right 1193593545 X:83419394-83419416 CATTGCAGGCAGAGCCTTGACGG No data
1193593535_1193593545 28 Left 1193593535 X:83419343-83419365 CCACTGCTGCAGCGAGAGCGCAG No data
Right 1193593545 X:83419394-83419416 CATTGCAGGCAGAGCCTTGACGG No data
1193593538_1193593545 -1 Left 1193593538 X:83419372-83419394 CCTTCCTCTCCTTGCCAACCACC No data
Right 1193593545 X:83419394-83419416 CATTGCAGGCAGAGCCTTGACGG No data
1193593541_1193593545 -10 Left 1193593541 X:83419381-83419403 CCTTGCCAACCACCATTGCAGGC No data
Right 1193593545 X:83419394-83419416 CATTGCAGGCAGAGCCTTGACGG No data
1193593536_1193593545 1 Left 1193593536 X:83419370-83419392 CCCCTTCCTCTCCTTGCCAACCA No data
Right 1193593545 X:83419394-83419416 CATTGCAGGCAGAGCCTTGACGG No data
1193593537_1193593545 0 Left 1193593537 X:83419371-83419393 CCCTTCCTCTCCTTGCCAACCAC No data
Right 1193593545 X:83419394-83419416 CATTGCAGGCAGAGCCTTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193593545 Original CRISPR CATTGCAGGCAGAGCCTTGA CGG Intergenic
No off target data available for this crispr