ID: 1193598388

View in Genome Browser
Species Human (GRCh38)
Location X:83477218-83477240
Sequence AGCCATTTGCAGAAGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193598383_1193598388 11 Left 1193598383 X:83477184-83477206 CCCTATTCAATAAATGGTGCTGG 0: 1053
1: 14483
2: 8914
3: 4532
4: 2163
Right 1193598388 X:83477218-83477240 AGCCATTTGCAGAAGATGGAAGG No data
1193598385_1193598388 10 Left 1193598385 X:83477185-83477207 CCTATTCAATAAATGGTGCTGGA 0: 131
1: 1609
2: 15284
3: 9515
4: 5213
Right 1193598388 X:83477218-83477240 AGCCATTTGCAGAAGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193598388 Original CRISPR AGCCATTTGCAGAAGATGGA AGG Intergenic
No off target data available for this crispr