ID: 1193598539

View in Genome Browser
Species Human (GRCh38)
Location X:83478956-83478978
Sequence CAAACAAACAAACAAAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193598537_1193598539 3 Left 1193598537 X:83478930-83478952 CCCTGTCTCAAAAACAAGCAAGC No data
Right 1193598539 X:83478956-83478978 CAAACAAACAAACAAAAAAGAGG No data
1193598538_1193598539 2 Left 1193598538 X:83478931-83478953 CCTGTCTCAAAAACAAGCAAGCA No data
Right 1193598539 X:83478956-83478978 CAAACAAACAAACAAAAAAGAGG No data
1193598535_1193598539 26 Left 1193598535 X:83478907-83478929 CCAGCCTGGGCGACAGAGGGACA No data
Right 1193598539 X:83478956-83478978 CAAACAAACAAACAAAAAAGAGG No data
1193598536_1193598539 22 Left 1193598536 X:83478911-83478933 CCTGGGCGACAGAGGGACACCCT No data
Right 1193598539 X:83478956-83478978 CAAACAAACAAACAAAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193598539 Original CRISPR CAAACAAACAAACAAAAAAG AGG Intergenic