ID: 1193598540

View in Genome Browser
Species Human (GRCh38)
Location X:83478974-83478996
Sequence AGAGGATGTAAACAACACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193598538_1193598540 20 Left 1193598538 X:83478931-83478953 CCTGTCTCAAAAACAAGCAAGCA No data
Right 1193598540 X:83478974-83478996 AGAGGATGTAAACAACACTATGG No data
1193598537_1193598540 21 Left 1193598537 X:83478930-83478952 CCCTGTCTCAAAAACAAGCAAGC No data
Right 1193598540 X:83478974-83478996 AGAGGATGTAAACAACACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193598540 Original CRISPR AGAGGATGTAAACAACACTA TGG Intergenic