ID: 1193598540 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:83478974-83478996 |
Sequence | AGAGGATGTAAACAACACTA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1193598538_1193598540 | 20 | Left | 1193598538 | X:83478931-83478953 | CCTGTCTCAAAAACAAGCAAGCA | No data | ||
Right | 1193598540 | X:83478974-83478996 | AGAGGATGTAAACAACACTATGG | No data | ||||
1193598537_1193598540 | 21 | Left | 1193598537 | X:83478930-83478952 | CCCTGTCTCAAAAACAAGCAAGC | No data | ||
Right | 1193598540 | X:83478974-83478996 | AGAGGATGTAAACAACACTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1193598540 | Original CRISPR | AGAGGATGTAAACAACACTA TGG | Intergenic | ||