ID: 1193601538

View in Genome Browser
Species Human (GRCh38)
Location X:83512572-83512594
Sequence ATGGAGAGGAAGAAGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193601538_1193601552 30 Left 1193601538 X:83512572-83512594 CCATCCTTCTTCTTCCTCTCCAT No data
Right 1193601552 X:83512625-83512647 CTCATTCCCCTGAGGAGGGATGG No data
1193601538_1193601549 26 Left 1193601538 X:83512572-83512594 CCATCCTTCTTCTTCCTCTCCAT No data
Right 1193601549 X:83512621-83512643 ATCCCTCATTCCCCTGAGGAGGG No data
1193601538_1193601548 25 Left 1193601538 X:83512572-83512594 CCATCCTTCTTCTTCCTCTCCAT No data
Right 1193601548 X:83512620-83512642 GATCCCTCATTCCCCTGAGGAGG No data
1193601538_1193601547 22 Left 1193601538 X:83512572-83512594 CCATCCTTCTTCTTCCTCTCCAT No data
Right 1193601547 X:83512617-83512639 CCTGATCCCTCATTCCCCTGAGG No data
1193601538_1193601543 -3 Left 1193601538 X:83512572-83512594 CCATCCTTCTTCTTCCTCTCCAT No data
Right 1193601543 X:83512592-83512614 CATTCTGTTAGGTTCCCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193601538 Original CRISPR ATGGAGAGGAAGAAGAAGGA TGG (reversed) Intergenic
No off target data available for this crispr