ID: 1193603946

View in Genome Browser
Species Human (GRCh38)
Location X:83542754-83542776
Sequence CAGCGCGATTCCGTGGGCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2942
Summary {0: 16, 1: 450, 2: 786, 3: 859, 4: 831}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193603946_1193603954 30 Left 1193603946 X:83542754-83542776 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 1193603954 X:83542807-83542829 GCAAGGCGGCAACGAGGCTGGGG 0: 316
1: 1145
2: 1873
3: 1683
4: 815
1193603946_1193603951 24 Left 1193603946 X:83542754-83542776 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 1193603951 X:83542801-83542823 CAAACTGCAAGGCGGCAACGAGG 0: 317
1: 1166
2: 1768
3: 1553
4: 836
1193603946_1193603953 29 Left 1193603946 X:83542754-83542776 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 1193603953 X:83542806-83542828 TGCAAGGCGGCAACGAGGCTGGG 0: 317
1: 1173
2: 1908
3: 1654
4: 702
1193603946_1193603950 16 Left 1193603946 X:83542754-83542776 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 1193603950 X:83542793-83542815 TCTGAGATCAAACTGCAAGGCGG 0: 2869
1: 1007
2: 456
3: 293
4: 360
1193603946_1193603949 13 Left 1193603946 X:83542754-83542776 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 1193603949 X:83542790-83542812 CAGTCTGAGATCAAACTGCAAGG 0: 3663
1: 1439
2: 732
3: 491
4: 588
1193603946_1193603952 28 Left 1193603946 X:83542754-83542776 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 1193603952 X:83542805-83542827 CTGCAAGGCGGCAACGAGGCTGG 0: 315
1: 1152
2: 1845
3: 1595
4: 741

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193603946 Original CRISPR CAGCGCGATTCCGTGGGCGT AGG (reversed) Intergenic
Too many off-targets to display for this crispr