ID: 1193605847

View in Genome Browser
Species Human (GRCh38)
Location X:83567155-83567177
Sequence TCACCTAGTTGGGTGGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193605842_1193605847 -8 Left 1193605842 X:83567140-83567162 CCTTGTTGGAAGGTCTCACCTAG No data
Right 1193605847 X:83567155-83567177 TCACCTAGTTGGGTGGCACAGGG No data
1193605841_1193605847 -7 Left 1193605841 X:83567139-83567161 CCCTTGTTGGAAGGTCTCACCTA No data
Right 1193605847 X:83567155-83567177 TCACCTAGTTGGGTGGCACAGGG No data
1193605836_1193605847 28 Left 1193605836 X:83567104-83567126 CCAGTAGGAACTCTTTTGTATAG No data
Right 1193605847 X:83567155-83567177 TCACCTAGTTGGGTGGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193605847 Original CRISPR TCACCTAGTTGGGTGGCACA GGG Intergenic