ID: 1193607444

View in Genome Browser
Species Human (GRCh38)
Location X:83585614-83585636
Sequence GGCCACAATTAACAGACACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193607440_1193607444 18 Left 1193607440 X:83585573-83585595 CCACACATAGCAATACTAAACTT No data
Right 1193607444 X:83585614-83585636 GGCCACAATTAACAGACACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193607444 Original CRISPR GGCCACAATTAACAGACACA GGG Intergenic
No off target data available for this crispr