ID: 1193607676

View in Genome Browser
Species Human (GRCh38)
Location X:83588563-83588585
Sequence CAGCAGAATGAGATGGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193607676_1193607685 14 Left 1193607676 X:83588563-83588585 CCAAACTCCATCTCATTCTGCTG No data
Right 1193607685 X:83588600-83588622 GGCAAGCTGGTGCCTGTCAGTGG No data
1193607676_1193607688 27 Left 1193607676 X:83588563-83588585 CCAAACTCCATCTCATTCTGCTG No data
Right 1193607688 X:83588613-83588635 CTGTCAGTGGGTTCCTCTCGAGG No data
1193607676_1193607686 15 Left 1193607676 X:83588563-83588585 CCAAACTCCATCTCATTCTGCTG No data
Right 1193607686 X:83588601-83588623 GCAAGCTGGTGCCTGTCAGTGGG No data
1193607676_1193607681 -7 Left 1193607676 X:83588563-83588585 CCAAACTCCATCTCATTCTGCTG No data
Right 1193607681 X:83588579-83588601 TCTGCTGGTCGGTGGCCTGCCGG No data
1193607676_1193607682 1 Left 1193607676 X:83588563-83588585 CCAAACTCCATCTCATTCTGCTG No data
Right 1193607682 X:83588587-83588609 TCGGTGGCCTGCCGGCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193607676 Original CRISPR CAGCAGAATGAGATGGAGTT TGG (reversed) Intergenic
No off target data available for this crispr