ID: 1193609647

View in Genome Browser
Species Human (GRCh38)
Location X:83614006-83614028
Sequence TGTTAACTATAGTCATCTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193609647_1193609649 10 Left 1193609647 X:83614006-83614028 CCCTAAGATGACTATAGTTAACA No data
Right 1193609649 X:83614039-83614061 TTTTCAAATAACTAGAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193609647 Original CRISPR TGTTAACTATAGTCATCTTA GGG (reversed) Intergenic
No off target data available for this crispr