ID: 1193611512

View in Genome Browser
Species Human (GRCh38)
Location X:83636923-83636945
Sequence CACAATGTACGTGGTTTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193611512_1193611515 -4 Left 1193611512 X:83636923-83636945 CCATTAAAACCACGTACATTGTG No data
Right 1193611515 X:83636942-83636964 TGTGTATCAGGTACTATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193611512 Original CRISPR CACAATGTACGTGGTTTTAA TGG (reversed) Intergenic
No off target data available for this crispr