ID: 1193616977

View in Genome Browser
Species Human (GRCh38)
Location X:83700939-83700961
Sequence TTGTATATGATTAAGAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193616975_1193616977 -8 Left 1193616975 X:83700924-83700946 CCATCTTGTTAATTTTTGTATAT 0: 4
1: 5
2: 19
3: 241
4: 2394
Right 1193616977 X:83700939-83700961 TTGTATATGATTAAGAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193616977 Original CRISPR TTGTATATGATTAAGAAAGG AGG Intergenic
No off target data available for this crispr