ID: 1193617008

View in Genome Browser
Species Human (GRCh38)
Location X:83701384-83701406
Sequence TTCTCTCCATGAACATGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193617007_1193617008 -2 Left 1193617007 X:83701363-83701385 CCATTTTGACAATATGATTCTTT No data
Right 1193617008 X:83701384-83701406 TTCTCTCCATGAACATGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193617008 Original CRISPR TTCTCTCCATGAACATGAGA TGG Intergenic
No off target data available for this crispr