ID: 1193620977

View in Genome Browser
Species Human (GRCh38)
Location X:83752027-83752049
Sequence CTGGGAGAATGGAACAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193620971_1193620977 11 Left 1193620971 X:83751993-83752015 CCAAATCTACTCTAATTGGTGTA No data
Right 1193620977 X:83752027-83752049 CTGGGAGAATGGAACAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193620977 Original CRISPR CTGGGAGAATGGAACAAAGT TGG Intergenic
No off target data available for this crispr