ID: 1193630699

View in Genome Browser
Species Human (GRCh38)
Location X:83883838-83883860
Sequence GTATAAACACAGCTGGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193630696_1193630699 10 Left 1193630696 X:83883805-83883827 CCAAAAAATGAATGAAAGAATTT 0: 1
1: 1
2: 6
3: 145
4: 1249
Right 1193630699 X:83883838-83883860 GTATAAACACAGCTGGAGCTAGG 0: 1
1: 0
2: 0
3: 7
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193630699 Original CRISPR GTATAAACACAGCTGGAGCT AGG Intronic
907249056 1:53125829-53125851 GTGTAAACAGAGCTGGAACATGG - Intronic
908829570 1:68165596-68165618 ATATGAACAGAGCTTGAGCTCGG + Intronic
909496826 1:76288201-76288223 GTAAAATCACAGCGGAAGCTTGG + Intronic
915489216 1:156242155-156242177 GTATAAACAGTGCTGGAGGCTGG + Exonic
918993084 1:191723750-191723772 GTTTGAGCACAGCTGGAGATGGG + Intergenic
919861312 1:201740801-201740823 GTGTAACCACAGCTGGCCCTGGG + Intronic
1071852417 10:89587288-89587310 GGATAAACACAGCTGACTCTTGG - Intronic
1073973979 10:109078365-109078387 GTATCAAAAAAGGTGGAGCTAGG - Intergenic
1074867992 10:117555941-117555963 GTAAAAGCACAGCTAGGGCTGGG + Intergenic
1075386507 10:122059210-122059232 TTAAAAACACAGATGGAGCCCGG - Intronic
1079282071 11:19096566-19096588 CTAGAAACACAGCTGGAGACTGG + Intergenic
1080610276 11:33898180-33898202 GCATAATCACAGCAGCAGCTTGG + Intergenic
1084256176 11:67944353-67944375 CTATAAACACAGCAGGTACTAGG + Intergenic
1084816585 11:71650946-71650968 CTATAAACACAGCAGGTACTAGG - Intergenic
1086108277 11:83170231-83170253 GAAAAAACAGAGCTGGAGGTGGG - Intronic
1087470568 11:98568779-98568801 TTAGAAACACACCTGCAGCTGGG - Intergenic
1089602532 11:119624362-119624384 CTCTAAACACAGCTGGGGCCAGG + Intronic
1089627020 11:119757752-119757774 AAAGAGACACAGCTGGAGCTGGG - Intergenic
1090986522 11:131771630-131771652 GTGTGTACACAGCTGGTGCTTGG - Intronic
1092426409 12:8379085-8379107 CTATAAACACAGCAGGTACTGGG + Intergenic
1097841204 12:64323220-64323242 ATTTAGACACAGCTGGAACTGGG - Intronic
1098351241 12:69563344-69563366 GGATAGACACAGCTGGAACATGG - Intronic
1098713843 12:73802983-73803005 GTAACAACACAGATGGAACTTGG - Intergenic
1101052964 12:100882994-100883016 GCATAAACAGAGCTCCAGCTGGG - Intronic
1101352323 12:103942994-103943016 GTATAAACATAGCAGCTGCTAGG + Intronic
1101681097 12:106966283-106966305 GCAGCAACACAGGTGGAGCTGGG - Intronic
1106278641 13:28241326-28241348 GTATATAGTCATCTGGAGCTTGG + Intronic
1109283205 13:60380729-60380751 ATATAAACAAAGCAGGAGGTGGG - Intergenic
1109663236 13:65493322-65493344 GCAGAAACACAGATGGAGTTGGG + Intergenic
1112388630 13:98962864-98962886 GAATAACCACAGCTGGGGGTGGG + Intronic
1113083777 13:106546357-106546379 GTAGAAACAAAGCTGGAGCCAGG - Intronic
1117332032 14:54722365-54722387 GCATAAACACAGCAGGAAGTAGG - Intronic
1118498352 14:66331512-66331534 GGATAAACAAAGCTAGAACTTGG - Intergenic
1120004796 14:79344273-79344295 GTATCCACCCAGCTGGTGCTAGG + Intronic
1120277743 14:82398639-82398661 GTATAAACACAGCCTGATCTGGG - Intergenic
1121829054 14:97033985-97034007 GTAACAACCCAGCTGGGGCTGGG - Intergenic
1126555398 15:49982327-49982349 GTCTATACACAGCAGTAGCTAGG - Intronic
1126750309 15:51870232-51870254 TTAAAAACACAGCTGTGGCTGGG - Intronic
1127894189 15:63280299-63280321 TTTGAAACACAGCTGGAACTTGG + Intronic
1128554685 15:68623451-68623473 GTGTAAACACAGCTGTGGGTGGG - Intronic
1128686123 15:69687041-69687063 CTAGAAACACATCTGGAGTTGGG + Intergenic
1130369379 15:83271343-83271365 GTTTGAACACAGCTGCAGCTAGG + Intronic
1132048561 15:98587435-98587457 ATATAAAGACAGCTGGGGCCAGG + Intergenic
1132225476 15:100137696-100137718 GTATAAAGACAGCTGGGTATGGG - Intronic
1132394119 15:101459681-101459703 CTATGAACACAGCTCCAGCTGGG + Intronic
1133167332 16:3957600-3957622 GCAGAACCAAAGCTGGAGCTGGG + Intronic
1133371889 16:5251481-5251503 CTATAAACACAGCAGGTACTAGG - Intergenic
1139515817 16:67451803-67451825 GCACAACCACAGCTGGAGGTTGG - Intronic
1139657404 16:68397395-68397417 GTATAAACCCAGCAGGAACCAGG + Intronic
1139740968 16:69034500-69034522 CTGTAACCACAGCTGGAGCCTGG - Intronic
1140187854 16:72790167-72790189 GTCTCAACACACCTGAAGCTTGG - Intronic
1143611397 17:8019897-8019919 GTGTAAACACATCTGAAGGTGGG - Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1148766072 17:50039044-50039066 TGAGAAACACACCTGGAGCTTGG - Intergenic
1149282363 17:55121807-55121829 GGATAAGGACAGATGGAGCTGGG + Intronic
1155015877 18:21838829-21838851 GTATCAACACAGATGGTTCTTGG - Intronic
1155786566 18:29909903-29909925 GAAAAAAAACAGCTGGATCTAGG - Intergenic
1156648533 18:39197154-39197176 CTATAAGCACAGATGAAGCTTGG + Intergenic
1159902509 18:74060786-74060808 GTATAAACACGGCTGCAGAAGGG + Intergenic
1160742080 19:691148-691170 TTGTAACCACAGCTGGAGCCGGG - Intronic
1161002085 19:1915631-1915653 TTATAAACACAGCAGGCACTGGG - Intronic
1163803467 19:19382279-19382301 GTGCAAACACAGTTGGGGCTGGG + Intergenic
1164925809 19:32129155-32129177 GAAAAATCCCAGCTGGAGCTTGG + Intergenic
1165805417 19:38577873-38577895 GTGTAGACACAGCTGGAGTGTGG - Intronic
1166421116 19:42636994-42637016 GTATAAACGCAGCTGTGGCAGGG - Intronic
1168017045 19:53582011-53582033 GCATAAACAGAGGAGGAGCTGGG + Intergenic
925990190 2:9248591-9248613 GAATAAACACACCTAGAACTAGG + Intronic
926782291 2:16484461-16484483 CTATAAACACATCTGAGGCTGGG - Intergenic
928060718 2:28110326-28110348 TTATAAACACAGGTGTGGCTGGG + Intronic
928268338 2:29831539-29831561 GGATCAACAGAGTTGGAGCTAGG - Intronic
931200360 2:60091817-60091839 GTAGAAACTCAGCTGGAGCCAGG - Intergenic
938053875 2:128198920-128198942 GAATAATCTCAGCTGGCGCTGGG - Intergenic
940263725 2:151814463-151814485 GTTTAAACAGGGCTGGAACTAGG + Intronic
941190954 2:162381057-162381079 GAAAAAATACAACTGGAGCTGGG + Intronic
942995485 2:182255178-182255200 CTATAAACACAGGTTGATCTAGG - Intronic
946175575 2:217920117-217920139 GTCTAAAGAAAGCTGCAGCTGGG + Intronic
948685883 2:239669604-239669626 GAATGAACCCAGCTGGAGCATGG + Intergenic
1172380848 20:34489759-34489781 GTACAAAAACAGCTGGACATAGG - Intronic
1172708582 20:36902101-36902123 GGATGAATACAGCTGGAGGTGGG + Intronic
1174365644 20:50054747-50054769 GAAGTCACACAGCTGGAGCTAGG + Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175832826 20:61976461-61976483 GTAGGCCCACAGCTGGAGCTGGG + Intronic
1177165633 21:17599773-17599795 TTATAAGTACAGCTGGGGCTGGG - Intronic
1177610615 21:23442795-23442817 GTATATTCCCAGCTGGAGATAGG - Intergenic
1178305494 21:31487192-31487214 GTCTGAAAACAGCTGGAGGTGGG + Intronic
1178713073 21:34937266-34937288 TTAAAAACACAGATGGACCTGGG + Intronic
1179305860 21:40153554-40153576 GTACAAGCACAGATGAAGCTAGG + Intronic
1179886374 21:44315937-44315959 GCACACACACAGCTGGGGCTGGG - Intronic
1180246285 21:46549986-46550008 AGATAAACAAAGCTGGAGCCAGG - Intronic
1180975529 22:19845790-19845812 GTGTGAACACTGCTGGGGCTGGG + Intronic
1182636877 22:31735099-31735121 GAATATACACTGGTGGAGCTGGG + Intronic
950974625 3:17227545-17227567 GTAGGAACATAGATGGAGCTGGG + Intronic
951709396 3:25573563-25573585 ATAAAAACACAGCTAGATCTGGG - Intronic
952079987 3:29746395-29746417 GTACAAACACAGCTGTAGTTTGG - Intronic
952341196 3:32449054-32449076 GTTTAAACAAAGCTCCAGCTCGG - Intronic
952667902 3:35929533-35929555 GTATAAATACAGCTAGATGTAGG - Intergenic
952814875 3:37438576-37438598 GAAAGAACACAGCAGGAGCTGGG - Intergenic
952863050 3:37830840-37830862 GTATTAATACATCTTGAGCTAGG + Intergenic
953709516 3:45258405-45258427 GTATACACACAGCAGGCACTTGG + Intergenic
957071093 3:75568390-75568412 CTATAAACACAGCAGGTACTAGG + Intergenic
958529335 3:95306247-95306269 ATATAAACACATGTGGAACTTGG - Intergenic
958928050 3:100180051-100180073 TTTTAGTCACAGCTGGAGCTGGG + Intergenic
961185679 3:124913065-124913087 GTCTTGCCACAGCTGGAGCTAGG - Intronic
961695628 3:128702293-128702315 CTATAAACAAAGCTGGAGACTGG - Intergenic
963017135 3:140835337-140835359 GATTAAACAAAGCTGGAGATTGG + Intergenic
965557525 3:170033512-170033534 GTAGTAAGACATCTGGAGCTAGG + Intergenic
965727651 3:171736125-171736147 GTATAGACAAGGCTGGACCTTGG - Intronic
967619540 3:191616312-191616334 TTAGAAAAACAGCTGGATCTCGG + Intergenic
969014693 4:4096087-4096109 CTATAAACACAGCAGGTACTAGG + Intergenic
969739248 4:9012353-9012375 CTATAAACACAGCAGGTACTAGG - Intergenic
969798432 4:9543866-9543888 CTATAAACACAGCAGGTACTAGG - Intergenic
970049652 4:11898869-11898891 GTATAATTTCAGCTGAAGCTAGG - Intergenic
970425227 4:15939723-15939745 ATATAAACACATCTGGATTTGGG - Intergenic
973333411 4:48932340-48932362 GTATAAACACAGATTGGGCATGG + Intergenic
978148140 4:105401928-105401950 GAATAAACACACCTGATGCTTGG - Intronic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
982850622 4:160310828-160310850 AAATAAACACAGCTGGAGAAAGG - Intergenic
983365404 4:166780611-166780633 TTAAAAACACAGCTGTACCTGGG + Intronic
983657527 4:170098327-170098349 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
985985867 5:3515752-3515774 GCAGAAACACTGCTGGATCTTGG + Intergenic
986830416 5:11571378-11571400 TTATGCACAAAGCTGGAGCTAGG - Intronic
987013322 5:13790787-13790809 GTATAAAAACTGCTGGAGACTGG - Intronic
987367067 5:17158363-17158385 GGACAATCACTGCTGGAGCTTGG + Intronic
990975155 5:61553594-61553616 GCAGCAACACAGCTGGAACTGGG - Intergenic
996087691 5:119321446-119321468 GAATAATCACATCTGGAGTTTGG - Intronic
997021038 5:130002079-130002101 CTATAAACAAAGGTGGTGCTTGG + Intronic
997789313 5:136743039-136743061 TTTTAGTCACAGCTGGAGCTGGG - Intergenic
998312251 5:141145571-141145593 GTAAAAATAAAGCAGGAGCTGGG + Intronic
1001923009 5:175615515-175615537 CTATAAACACGGCTGTAGCTGGG - Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1006541847 6:34746378-34746400 GTGTAAACATAGCTGTGGCTGGG - Intergenic
1008452195 6:51665923-51665945 GTGTAAGCACAGGTGGAGGTGGG + Intronic
1008848215 6:55993793-55993815 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
1009594055 6:65711528-65711550 GTACAAACAAAAATGGAGCTGGG - Intergenic
1013216814 6:108034911-108034933 AAATAAACCCAGCTGGGGCTGGG - Intergenic
1013229040 6:108144734-108144756 TTTTAAACACAAATGGAGCTGGG + Intronic
1013377617 6:109533373-109533395 GTATAAAAACAGCTGCATCTGGG + Exonic
1014862029 6:126480713-126480735 GTATAGACACTGCTTGTGCTGGG + Intergenic
1016126291 6:140408337-140408359 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1016785868 6:148010506-148010528 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1021773930 7:24032973-24032995 GTAGGAACATAGATGGAGCTGGG - Intergenic
1024656992 7:51459285-51459307 TCAGAAACACAGCTGGAGCCTGG - Intergenic
1025943670 7:66090687-66090709 GGGTAAAGACAGCTGGAGCCAGG - Intronic
1026849438 7:73715913-73715935 GTGTACACACAGCTGGAGGCTGG - Intronic
1028539167 7:91923602-91923624 ATAATAACAGAGCTGGAGCTGGG + Intergenic
1029073365 7:97917717-97917739 CTATAAACACAGCAGGTACTAGG + Intergenic
1030285916 7:107826634-107826656 GAGTAATCACACCTGGAGCTGGG + Intergenic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1036256420 8:7210166-7210188 CTATAAACACAGCAGGTACTAGG + Intergenic
1036308470 8:7668751-7668773 CTATAAACACAGCAGGTACTAGG + Intergenic
1036361064 8:8077326-8077348 CTATAAACACAGCAGGTACTAGG - Intergenic
1036648916 8:10629744-10629766 GTAGAAAGACAGGAGGAGCTGGG - Intronic
1036889899 8:12589675-12589697 CTATAAACACAGCAGGTACTAGG + Intergenic
1036897506 8:12647836-12647858 CTATAAACACAGCAGGTACTAGG + Intergenic
1042651761 8:71050521-71050543 GAATTAAGACAGCAGGAGCTTGG + Intergenic
1045571509 8:103372402-103372424 GGACAACCACAGCTGGGGCTAGG + Intronic
1051539826 9:18203129-18203151 GTATAAACAGAGCATGAGCACGG - Intergenic
1052596631 9:30569112-30569134 TTAAAAACTGAGCTGGAGCTAGG - Intergenic
1053148822 9:35730232-35730254 GTCTAAGTAAAGCTGGAGCTGGG + Intronic
1056944899 9:90985904-90985926 GAAGAAACACAGCTGGATTTGGG - Intergenic
1058800832 9:108543169-108543191 ATATAAACACAGCAGCAGGTGGG - Intergenic
1062083270 9:134635748-134635770 ATATACACGCAGCTGGAGGTTGG - Intergenic
1062345308 9:136111728-136111750 GCAGAAACACAGCTGCTGCTGGG + Intergenic
1187519781 X:20003283-20003305 GGACACACACAGCTGGAACTTGG - Intergenic
1187653649 X:21442846-21442868 GCAGCAACACAGATGGAGCTTGG + Intronic
1188233795 X:27700344-27700366 GTATTAACACATCTGGAAATGGG + Intronic
1188323362 X:28768291-28768313 CTATAAACACATCTGCTGCTTGG + Intronic
1193630699 X:83883838-83883860 GTATAAACACAGCTGGAGCTAGG + Intronic
1194833641 X:98656483-98656505 GTATAAACAAATCTGGAGAACGG + Intergenic
1197552474 X:127910084-127910106 GTATGAACATGGATGGAGCTGGG + Intergenic
1197953159 X:131919196-131919218 GTATCAACTCAGCTGCAGTTGGG + Intergenic