ID: 1193635972

View in Genome Browser
Species Human (GRCh38)
Location X:83949117-83949139
Sequence CCTTCTCAGCAGGAGCAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193635965_1193635972 6 Left 1193635965 X:83949088-83949110 CCACTGGGACTGGCACCAGGAAG No data
Right 1193635972 X:83949117-83949139 CCTTCTCAGCAGGAGCAGCTAGG No data
1193635968_1193635972 -9 Left 1193635968 X:83949103-83949125 CCAGGAAGGGCAGCCCTTCTCAG No data
Right 1193635972 X:83949117-83949139 CCTTCTCAGCAGGAGCAGCTAGG No data
1193635964_1193635972 7 Left 1193635964 X:83949087-83949109 CCCACTGGGACTGGCACCAGGAA No data
Right 1193635972 X:83949117-83949139 CCTTCTCAGCAGGAGCAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193635972 Original CRISPR CCTTCTCAGCAGGAGCAGCT AGG Intergenic
No off target data available for this crispr