ID: 1193636704

View in Genome Browser
Species Human (GRCh38)
Location X:83959309-83959331
Sequence CTTTCTATGCTGATTTTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193636704_1193636706 -10 Left 1193636704 X:83959309-83959331 CCCAGCAAAATCAGCATAGAAAG No data
Right 1193636706 X:83959322-83959344 GCATAGAAAGACATAACTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193636704 Original CRISPR CTTTCTATGCTGATTTTGCT GGG (reversed) Intergenic
No off target data available for this crispr