ID: 1193638222

View in Genome Browser
Species Human (GRCh38)
Location X:83979443-83979465
Sequence TATGCCTGAGTAGTATTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193638222_1193638226 23 Left 1193638222 X:83979443-83979465 CCATGGAATACTACTCAGGCATA No data
Right 1193638226 X:83979489-83979511 TGCAGCAATCCGGATGGAGTTGG No data
1193638222_1193638224 13 Left 1193638222 X:83979443-83979465 CCATGGAATACTACTCAGGCATA No data
Right 1193638224 X:83979479-83979501 TAATGGCATTTGCAGCAATCCGG 0: 27
1: 530
2: 781
3: 1197
4: 2229
1193638222_1193638225 17 Left 1193638222 X:83979443-83979465 CCATGGAATACTACTCAGGCATA No data
Right 1193638225 X:83979483-83979505 GGCATTTGCAGCAATCCGGATGG No data
1193638222_1193638223 -4 Left 1193638222 X:83979443-83979465 CCATGGAATACTACTCAGGCATA No data
Right 1193638223 X:83979462-83979484 CATAAAAAAGAAAAAAATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193638222 Original CRISPR TATGCCTGAGTAGTATTCCA TGG (reversed) Intergenic
No off target data available for this crispr