ID: 1193638226

View in Genome Browser
Species Human (GRCh38)
Location X:83979489-83979511
Sequence TGCAGCAATCCGGATGGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193638222_1193638226 23 Left 1193638222 X:83979443-83979465 CCATGGAATACTACTCAGGCATA No data
Right 1193638226 X:83979489-83979511 TGCAGCAATCCGGATGGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193638226 Original CRISPR TGCAGCAATCCGGATGGAGT TGG Intergenic
No off target data available for this crispr