ID: 1193640217

View in Genome Browser
Species Human (GRCh38)
Location X:84003226-84003248
Sequence GTGCAAGTATAGGTGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193640217_1193640225 6 Left 1193640217 X:84003226-84003248 CCCTCCTCCACCTATACTTGCAC No data
Right 1193640225 X:84003255-84003277 ATGACCTCTCTGAACTTCTGGGG No data
1193640217_1193640223 4 Left 1193640217 X:84003226-84003248 CCCTCCTCCACCTATACTTGCAC No data
Right 1193640223 X:84003253-84003275 CCATGACCTCTCTGAACTTCTGG No data
1193640217_1193640224 5 Left 1193640217 X:84003226-84003248 CCCTCCTCCACCTATACTTGCAC No data
Right 1193640224 X:84003254-84003276 CATGACCTCTCTGAACTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193640217 Original CRISPR GTGCAAGTATAGGTGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr