ID: 1193640811

View in Genome Browser
Species Human (GRCh38)
Location X:84007954-84007976
Sequence TGGAGTGTAAGCAGCACTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193640811_1193640820 27 Left 1193640811 X:84007954-84007976 CCCCTAGTGCTGCTTACACTCCA No data
Right 1193640820 X:84008004-84008026 GTCCCCTTTTGAATTATAACGGG No data
1193640811_1193640819 26 Left 1193640811 X:84007954-84007976 CCCCTAGTGCTGCTTACACTCCA No data
Right 1193640819 X:84008003-84008025 TGTCCCCTTTTGAATTATAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193640811 Original CRISPR TGGAGTGTAAGCAGCACTAG GGG (reversed) Intergenic
No off target data available for this crispr