ID: 1193644263

View in Genome Browser
Species Human (GRCh38)
Location X:84047597-84047619
Sequence CAGTGGGCTTGGAGGGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193644263_1193644274 13 Left 1193644263 X:84047597-84047619 CCCACTCCCCTCCAAGCCCACTG No data
Right 1193644274 X:84047633-84047655 CAGTGTCAGCAGCAGCCCCAGGG No data
1193644263_1193644270 -10 Left 1193644263 X:84047597-84047619 CCCACTCCCCTCCAAGCCCACTG No data
Right 1193644270 X:84047610-84047632 AAGCCCACTGGTGACAGCAGTGG No data
1193644263_1193644275 24 Left 1193644263 X:84047597-84047619 CCCACTCCCCTCCAAGCCCACTG No data
Right 1193644275 X:84047644-84047666 GCAGCCCCAGGGCAGAACACAGG No data
1193644263_1193644273 12 Left 1193644263 X:84047597-84047619 CCCACTCCCCTCCAAGCCCACTG No data
Right 1193644273 X:84047632-84047654 GCAGTGTCAGCAGCAGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193644263 Original CRISPR CAGTGGGCTTGGAGGGGAGT GGG (reversed) Intergenic
No off target data available for this crispr