ID: 1193646538

View in Genome Browser
Species Human (GRCh38)
Location X:84076386-84076408
Sequence ACACAGATGCAAAAATTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 361}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193646535_1193646538 -8 Left 1193646535 X:84076371-84076393 CCACATCCCTCATGAACACAGAT 0: 1
1: 3
2: 10
3: 67
4: 340
Right 1193646538 X:84076386-84076408 ACACAGATGCAAAAATTGTAAGG 0: 1
1: 0
2: 2
3: 32
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193646538 Original CRISPR ACACAGATGCAAAAATTGTA AGG Intronic
901612578 1:10510582-10510604 ACACACATGCAAAATATATACGG - Intronic
902995183 1:20219144-20219166 ATACAGATGAAAAGACTGTAAGG - Intergenic
903522813 1:23965690-23965712 CAACAGATGCAAAAATTAAAGGG + Intronic
908037494 1:60072128-60072150 ATACAGAATCATAAATTGTAAGG - Intronic
908306281 1:62821751-62821773 ACATACATGCAAATATTGAAAGG - Intronic
908379804 1:63586327-63586349 ACACAGATGCTTTAATTTTATGG - Intronic
909609995 1:77541465-77541487 ACTCAGAGGCAAACATTGTGGGG + Intronic
909926080 1:81439580-81439602 ACACAGATGCAAACTCTGTGCGG + Intronic
910917567 1:92306918-92306940 ACACAGGTGCTAAAACTGAAAGG + Intronic
911371525 1:97000276-97000298 AAAAAGTTGCAAAAATAGTATGG + Intergenic
912112612 1:106362071-106362093 ACACATATGACAAAATTGCATGG - Intergenic
912315370 1:108663062-108663084 CCACAGTTTCAAAAATTTTAAGG + Intergenic
913507690 1:119533435-119533457 ACACTGATGCATAAATGGTCAGG - Intergenic
913571723 1:120126989-120127011 GCACATATGCTAAAATTGGAAGG + Intergenic
914292643 1:146288611-146288633 GCACATATGCTAAAATTGGAAGG + Intergenic
914408297 1:147399908-147399930 ACATATATGCTAAAATTTTATGG - Intergenic
914553687 1:148739394-148739416 GCACATATGCTAAAATTGGAAGG + Intergenic
915839460 1:159202958-159202980 ACACAGAAGCCATATTTGTACGG + Intronic
916209306 1:162346953-162346975 ACAGAGATGGAAAAATGTTAAGG - Intronic
918733897 1:188034248-188034270 AAAAAAATGCAAAAATTGTAAGG + Intergenic
919217410 1:194576919-194576941 ACACAGTTGCACAAATTGTTTGG - Intergenic
919742503 1:200989398-200989420 ACACAGATGCACACCATGTAGGG + Intronic
921439435 1:215167079-215167101 AGAAAGATGGAAATATTGTAGGG + Intronic
922895638 1:229097846-229097868 ACACGTATGCAAAAGTTGTTCGG - Intergenic
923829109 1:237535675-237535697 GCATAGATGCAAAAATGCTAAGG + Intronic
924148003 1:241097258-241097280 CCACAGATGTAAAAAGTGCAAGG + Intronic
1063610226 10:7555406-7555428 AGACAGATGAAGAAATTGAAAGG + Intergenic
1064499825 10:15958504-15958526 ACAAAAATGTAAAAATTGAAAGG - Intergenic
1064844166 10:19632756-19632778 AGACATATGTAAAAATTGTTGGG - Intronic
1065277940 10:24105190-24105212 TCACAGAGGCAAAAAAAGTAAGG + Intronic
1065469638 10:26064439-26064461 GCACAGATGCACAAATCATATGG + Intronic
1065681850 10:28243761-28243783 ACACAGATACAAAAATATAAAGG + Intronic
1065685731 10:28282737-28282759 ACACAGATCCGAACAGTGTAAGG - Intronic
1065725919 10:28667934-28667956 GCACATATGCTAAAATTGGAAGG + Intergenic
1066624063 10:37388657-37388679 ATACAAATGTAAAAGTTGTAAGG - Intergenic
1067671735 10:48330078-48330100 ACACACATGTATAATTTGTAAGG + Intronic
1068200865 10:53782705-53782727 ACACAGATGACAATATTGAAAGG + Intergenic
1068366250 10:56053957-56053979 ACACAGATACAAAAAAATTAAGG - Intergenic
1068832348 10:61510677-61510699 ACACATATGTAATAATTTTAAGG - Intergenic
1069091802 10:64208271-64208293 AGACAGAGACAAAAATTGAAGGG - Intergenic
1069097622 10:64278754-64278776 ACACATATGAAAACATGGTAAGG - Intergenic
1070717565 10:78733610-78733632 ACACAGATGCATGTCTTGTATGG - Intergenic
1071181832 10:82995152-82995174 ATACAGATAAAAACATTGTAAGG + Intergenic
1071512454 10:86270897-86270919 AGACAGCTGAAGAAATTGTAGGG - Intronic
1071694012 10:87853094-87853116 AAAAAGTTGCAAAAATGGTATGG + Intergenic
1071820943 10:89280261-89280283 AAACATATGCAAAAAATTTAAGG + Intronic
1072085005 10:92070398-92070420 ACACAGAGGAACTAATTGTAGGG + Intronic
1072911496 10:99505781-99505803 ACACAGATTGAAAAATTCTAAGG + Intergenic
1073170364 10:101501805-101501827 AATCAGATGCATAAATTTTATGG + Intronic
1074841370 10:117355380-117355402 AGACAGATACATAAATAGTATGG - Intronic
1075308369 10:121389379-121389401 GCAAAGTTGCAAAAATAGTACGG - Intergenic
1080186905 11:29500664-29500686 AAAAGGATGCAAAAATTGTGTGG + Intergenic
1081106521 11:39077214-39077236 ATATAGATGCAAAAATTCTCAGG + Intergenic
1081682919 11:45021433-45021455 ACAAAGTTGCAAAAATAGTTTGG - Intergenic
1084850669 11:71937227-71937249 ACAGAGATGAAAAAATGATAAGG - Intronic
1085441095 11:76563068-76563090 ACACAGATGTAAAAACTGGCAGG + Intergenic
1086026672 11:82301729-82301751 CCACAGATGCAAACATGGTGGGG + Intergenic
1086841157 11:91685961-91685983 ACACAGATGCAATAATAGGTAGG - Intergenic
1089896547 11:121935765-121935787 ACACAGATCCAAACAATATAAGG + Intergenic
1089985727 11:122811355-122811377 ACTCAGATGCATAAAACGTAAGG + Exonic
1090448269 11:126783250-126783272 CCACAGAGGCAGAGATTGTAGGG - Intronic
1091650438 12:2305136-2305158 ACACAGATGCACACACTGCAGGG + Intronic
1092469941 12:8768467-8768489 AAACAGATGAAAACATTCTAAGG - Intronic
1093136935 12:15463286-15463308 ACAGAGATTCAAATATTGGATGG - Intronic
1093401286 12:18749873-18749895 TAACAAATGCAAAAATTGAAAGG + Intergenic
1093778832 12:23110347-23110369 AAACATATGCAAAAATTAAATGG - Intergenic
1094019964 12:25903730-25903752 ACACACATGCAAACATGGCAAGG + Intergenic
1094451558 12:30588119-30588141 AGACAGATGCCAAACTTTTATGG + Intergenic
1094711453 12:32967368-32967390 ACAAAAATGTAAAAATTTTAAGG + Intergenic
1095372981 12:41491843-41491865 ACACAGAGGCAAAAATTTGCAGG - Intronic
1095548527 12:43403025-43403047 AAACAAATGCAAAATTTGCAAGG + Intronic
1095579906 12:43785537-43785559 ACATAGATATAAAAATTGGAAGG + Intronic
1096944605 12:55390872-55390894 TCACAGATGCAAATATCATATGG - Intergenic
1097261251 12:57721396-57721418 ACTCAGAAGCACAAATTGTAGGG - Exonic
1098824325 12:75274339-75274361 TCACAGACGCAAAAATGGCATGG - Intergenic
1099843508 12:87997970-87997992 ACACATATGTAAAAAATGTGAGG + Intronic
1100181711 12:92093231-92093253 ACAAAAATGCAAAAATTATCTGG - Intronic
1100717077 12:97317275-97317297 TTACAGATGAAAAAGTTGTAGGG - Intergenic
1101149829 12:101874336-101874358 ACACAGATATAAGAATTGTCTGG - Intergenic
1101695917 12:107126451-107126473 AGACAATTGCAAAAATGGTAGGG - Intergenic
1104601884 12:130160653-130160675 TTACCGATGTAAAAATTGTAGGG + Intergenic
1105562554 13:21508044-21508066 ACACAGGAGATAAAATTGTAGGG - Intronic
1105640442 13:22257688-22257710 ACACAGCTGCAAAATATGTGAGG - Intergenic
1106374217 13:29168871-29168893 ACACAGATTCATAAAGTGAAAGG - Intronic
1106426813 13:29638589-29638611 ACACAGCTTCAAAATATGTAAGG + Intergenic
1106789395 13:33139334-33139356 TCACAGTTGCATAAATTGAAGGG - Intronic
1106895574 13:34297730-34297752 AGACAGATGGAAAAAATATAAGG - Intergenic
1107065149 13:36205631-36205653 ACATAGATGCAAAAATCTAAAGG - Intronic
1107651752 13:42552197-42552219 ACACAGAAGAAAATATTTTATGG + Intergenic
1107743704 13:43482522-43482544 AGCAAGATGAAAAAATTGTAAGG + Intronic
1108093346 13:46874624-46874646 AAACAGATGCAAACAATGGAAGG + Intronic
1108368010 13:49736716-49736738 ATACAGGTGATAAAATTGTATGG - Intronic
1108911322 13:55555457-55555479 ACAAACAAGCAAAAACTGTAAGG - Intergenic
1108953561 13:56121170-56121192 TCTCAGTTGCAAAAATTGAATGG - Intergenic
1110031546 13:70620531-70620553 ACACATATGCAAAAATATAAAGG - Intergenic
1110423392 13:75338391-75338413 ACAAAAATACAAAAACTGTATGG + Intronic
1111132712 13:83997627-83997649 ATACATATTCCAAAATTGTATGG + Intergenic
1112209098 13:97356407-97356429 AAAAAAATGCAAAATTTGTAAGG - Intronic
1112924653 13:104659406-104659428 CCACAGATGCAAAAAATATCAGG - Intergenic
1112971219 13:105265629-105265651 ACAAAAAGACAAAAATTGTATGG + Intergenic
1113003612 13:105673216-105673238 ACAAAGATGCAAAAATCCAATGG - Intergenic
1113455139 13:110443392-110443414 AAACAGATGAAAAGAATGTATGG - Intronic
1114771831 14:25436003-25436025 ACAGAGATGCAAAGACAGTATGG + Intergenic
1115057826 14:29152334-29152356 TTACAAATACAAAAATTGTAGGG + Intergenic
1115061662 14:29198791-29198813 ACCCAAATGCAAAAATGGAATGG + Intergenic
1116147493 14:41093748-41093770 ACAAAAATGCAAAATTAGTAGGG - Intergenic
1116320873 14:43460774-43460796 ACACAAATGCAAAGATTTCAAGG + Intergenic
1116806869 14:49502153-49502175 ACACACGTGCTAAAATTGTATGG + Intergenic
1116876189 14:50114496-50114518 TCAAAGATGGATAAATTGTAGGG - Intronic
1118213862 14:63789855-63789877 GTAGAGATGAAAAAATTGTAGGG + Intergenic
1118930528 14:70236175-70236197 ACACTGATGCTAAAATTGAAAGG - Intergenic
1118954337 14:70466077-70466099 ACACTGATGGTAAAATTGAAAGG + Intergenic
1119748212 14:77059365-77059387 ATACAGAAGCAAAAACTTTAGGG + Intergenic
1121045302 14:90783350-90783372 ACACCCATGCAAAAGATGTACGG + Intronic
1124154699 15:27215629-27215651 ACACATTTGCAAAACTTGCATGG + Intronic
1126292364 15:47096457-47096479 AAACAAATGTAAAAACTGTAAGG - Intergenic
1128761914 15:70222829-70222851 ACAGAGATTCAAACAATGTAAGG - Intergenic
1129436585 15:75546308-75546330 ACTCAGATCCCAAAATTGTCAGG + Intronic
1129609384 15:77040732-77040754 AGACAGATGTAGAAATTATAGGG - Intergenic
1130065562 15:80600899-80600921 ACACAGATGAAAACATCGCAAGG + Intergenic
1133463356 16:6006591-6006613 ACACAGGTGTAATAATTATAAGG - Intergenic
1134145903 16:11761823-11761845 ACACATAAGCAAAAAGTTTAAGG - Intronic
1134859525 16:17548768-17548790 ACACAGATGCCAAGACAGTAAGG + Intergenic
1135569335 16:23536250-23536272 ACACAGATGGAATGCTTGTAAGG + Intronic
1138792089 16:59917845-59917867 CCACAGGTGCAAAAATTCTATGG - Intergenic
1139254119 16:65524732-65524754 ACACAGATGCAAGAATTTCCAGG + Intergenic
1141052207 16:80779719-80779741 AAACAGTTGCAAAAATTGTATGG + Intronic
1146898520 17:36564291-36564313 ACACAGATGCATAAAATGCTGGG - Intronic
1147786491 17:42981916-42981938 CCAGAGATGCAAAGCTTGTAAGG - Intronic
1149257607 17:54844451-54844473 ACACAGATGGAAATAGTGTATGG + Intergenic
1151523398 17:74647245-74647267 ATCCAGATGCATAAACTGTATGG + Intergenic
1151561302 17:74871304-74871326 ACACAGATGCTTGAAATGTAGGG - Intronic
1153156294 18:2153282-2153304 AAACAGGTCCAAACATTGTAGGG - Intergenic
1153399769 18:4670660-4670682 ACACAAATGCAAAAATACTCAGG + Intergenic
1153678960 18:7481997-7482019 ACACAAATGCAAATGTTCTAAGG + Intergenic
1155055630 18:22180181-22180203 ACACATATACTAAAATTGGAAGG - Intronic
1155162844 18:23209493-23209515 GCACACATGCAAAAATTCTGTGG - Intronic
1155225478 18:23725865-23725887 CCACAAATGCAAACATTCTATGG + Intronic
1155446334 18:25916643-25916665 AAACAGATACAACAAATGTAAGG - Intergenic
1156831466 18:41497204-41497226 TCATATCTGCAAAAATTGTAAGG + Intergenic
1156947375 18:42851497-42851519 GCATAGAAGCAAAAATTGAAAGG + Intronic
1157366448 18:47068994-47069016 AAAAAGCTGCAAAAATTGTCAGG + Intronic
1157760461 18:50260105-50260127 ACACAGAGGGAAGATTTGTATGG - Intronic
1158029849 18:52950154-52950176 AGACAGATACAAAAATTTGATGG - Intronic
1158118332 18:54021878-54021900 ACACAGAAGCAAAAGATGTTTGG - Intergenic
1158183324 18:54742876-54742898 ACATAGATGCAAAATTTGCAAGG - Intronic
1158345843 18:56516304-56516326 AAACAGATGTTAAAAATGTAAGG + Intergenic
1159633043 18:70771859-70771881 AAACAGATGCAATATTGGTAAGG + Intergenic
1159729984 18:72014031-72014053 ACAGGGATGCAAAAACTGAAAGG - Intergenic
1160253824 18:77229860-77229882 ATACAGATGAAAAAATAATAAGG + Intergenic
1164322988 19:24167398-24167420 AAACAGAAGCAAAAATTTTGTGG + Intergenic
1165294683 19:34917045-34917067 ACACAGATGAAGAGATGGTATGG + Intergenic
1165610922 19:37151644-37151666 CCACAGATGCCACACTTGTAGGG + Exonic
1165614291 19:37185282-37185304 CCACAGATGCCACACTTGTAGGG + Exonic
1167354750 19:48996485-48996507 ACACAGATACAAAAATTAGCTGG - Intronic
926421851 2:12707779-12707801 TCTCAGGTGCAAAAATTGAAAGG - Intergenic
927993396 2:27464517-27464539 ACACATATGCATAGATTGAAGGG + Intronic
930353551 2:50288919-50288941 AGTCAGATGCAGAGATTGTAGGG + Intronic
931142338 2:59476188-59476210 ACACAGATGCAAAAAAATTCAGG + Intergenic
932867519 2:75361062-75361084 AGAAAAATGCAAAAATTTTAAGG - Intergenic
933888362 2:86741529-86741551 ACACAGAAGGCAAAATTGAAAGG - Intronic
933921816 2:87055176-87055198 ACACAGAAGGCAAAATTGAAAGG + Intergenic
935075402 2:99738290-99738312 ACACAGATGGAAAATATGAAAGG - Intronic
935733626 2:106087852-106087874 ACACAGCTGCAAAAAATGTGAGG - Intergenic
936615087 2:114040333-114040355 AGACAGATGTAAAAGTTGGAGGG - Intergenic
936749139 2:115619501-115619523 AAAAAGATGCGAGAATTGTAAGG - Intronic
937057054 2:118947178-118947200 ACATACATGGAAAAATTGTTAGG - Intronic
938395579 2:130945282-130945304 ACACAGTTGCAGGAAGTGTATGG - Intronic
939267787 2:139896300-139896322 ATACTGAAACAAAAATTGTAAGG - Intergenic
939356316 2:141107936-141107958 ACACAGTTGGAAAAAAAGTATGG + Intronic
939970730 2:148656804-148656826 ACACAGATGAACACATTTTAAGG + Intronic
940164322 2:150752543-150752565 ACACAGATGGAAAAACTGTAGGG - Intergenic
940237828 2:151529832-151529854 GCACAGAAACAAAAATTATATGG - Intronic
940342152 2:152592572-152592594 ATACATATGCAGAAATAGTAAGG + Intronic
940419739 2:153466086-153466108 ACAGAGATACAAAAATTAGATGG - Intergenic
940553021 2:155185716-155185738 ACACAGATTCACAAAGAGTAAGG + Intergenic
941457139 2:165722366-165722388 ACCAAGATTTAAAAATTGTAAGG + Intergenic
941544614 2:166832995-166833017 ACCCAGATTAAAAAATTGAACGG - Intergenic
943016767 2:182521546-182521568 ACACAGCTAAAAAAAATGTAAGG + Intronic
943823090 2:192352579-192352601 ACACACATGATAAAATTGTATGG - Intergenic
945342710 2:208676285-208676307 ACAAAAATGCAAAAATTAGATGG - Intronic
945921520 2:215760047-215760069 AGACAGTTGCAAACAGTGTATGG + Intergenic
946363413 2:219233468-219233490 ACAGAGATGCAAAAAAAGTATGG - Intronic
947286505 2:228522513-228522535 ACAGAGCTGCAATAAATGTATGG + Intergenic
1169684470 20:8255329-8255351 ACACAGATACAAACACTGGATGG + Intronic
1170092622 20:12607974-12607996 ATACAGTTGCCAAAATTGCATGG + Intergenic
1171329902 20:24328388-24328410 ACAAAGGTGCAAACATGGTAAGG + Intergenic
1176582062 21:8540264-8540286 AAACAAATGTAAAAACTGTAAGG - Intergenic
1176880751 21:14189945-14189967 ACACACATGCAAAATTTCAAAGG - Intronic
1177902755 21:26936564-26936586 ACACAGATTGACAAATTCTAAGG - Intronic
1180013596 21:45068288-45068310 AATCAGATGCAAAAACAGTATGG - Intergenic
1180264899 22:10517312-10517334 AAACAAATGTAAAAACTGTAAGG - Intergenic
1182337141 22:29591579-29591601 ACAAAAATGCAAAAATTGCCGGG + Intergenic
1183822672 22:40359382-40359404 AGAAAAAGGCAAAAATTGTAAGG - Intronic
949708996 3:6853004-6853026 ACAAAGAATCAAAACTTGTAAGG + Intronic
950117847 3:10462990-10463012 ACATATATGCAAAAGTTGGAAGG - Intronic
952223096 3:31344706-31344728 ACACAAATGGAAACATTATAAGG + Intergenic
952245217 3:31581606-31581628 ACACAGATGCATAAATCCTTAGG - Intronic
952866502 3:37858860-37858882 AGAAAGATTCAAAAATTGTTGGG - Intergenic
953067780 3:39490557-39490579 AAAAAAATGAAAAAATTGTAAGG - Intronic
953216785 3:40926024-40926046 ATACAGATGCAAATTTTGTGGGG + Intergenic
953220386 3:40965434-40965456 ACATATATGCAAAAATTCTCAGG - Intergenic
953847272 3:46437833-46437855 ACACAGGTGTAAAAATGTTAAGG - Intronic
954976800 3:54703618-54703640 ACAAAGATGGGATAATTGTAGGG - Intronic
956442196 3:69291464-69291486 TCACATATGCAAAAGTCGTAAGG + Intronic
957288573 3:78248344-78248366 ACATATATTCTAAAATTGTATGG + Intergenic
957611880 3:82477892-82477914 AAACATATGTAAAAATTGAAAGG - Intergenic
958907943 3:99962241-99962263 AAACAGATGCAGAAATGCTAGGG + Intronic
959335908 3:105065304-105065326 ACACAGGTGCAAAGATCCTATGG + Intergenic
959459498 3:106607389-106607411 ACACAGATACAAAACATATACGG + Intergenic
959840532 3:110969353-110969375 ACACAGACGGAAACAATGTAAGG - Intergenic
960307275 3:116076830-116076852 ACATAAATGCAAAAATTGAAAGG - Intronic
960647700 3:119907258-119907280 ACAAGGCTGAAAAAATTGTAAGG + Intronic
963563811 3:146901769-146901791 AGACAGATGTAAAAATTTTCAGG - Intergenic
964602602 3:158518173-158518195 ATGCAGATGCAAAAAGGGTATGG - Intronic
965002896 3:162980578-162980600 AGACAGAGGCAGAAATTGGAGGG - Intergenic
965175982 3:165333130-165333152 ACAAAGATGTGAAAATTCTAAGG - Intergenic
965257557 3:166434682-166434704 GGACAGATGCAAAGAGTGTAAGG - Intergenic
965740942 3:171873963-171873985 AAACAGATACAAAACTTTTATGG + Intronic
966364200 3:179165097-179165119 ACACTGCTGTAAAAATTGTCAGG + Intronic
966511144 3:180765042-180765064 ACAAATATGCAAAAATTGTCAGG + Intronic
967225044 3:187282897-187282919 TCACAGATGCAAGGACTGTAGGG + Intronic
967542387 3:190682475-190682497 ATACATGTTCAAAAATTGTATGG + Intergenic
968847166 4:3051021-3051043 ACACACACACACAAATTGTAAGG - Intergenic
969323847 4:6429461-6429483 AAACAAATGAAAAAATTGTAAGG + Intronic
970317841 4:14846337-14846359 TCACAGATGAAAAAATTGTGAGG + Intergenic
970359730 4:15296948-15296970 AAACATTTGCAAAAAATGTAGGG + Intergenic
971627960 4:28947923-28947945 ACAGGAATGTAAAAATTGTATGG + Intergenic
971891971 4:32536281-32536303 ACACAAATGAAAACATTCTAAGG + Intergenic
972062498 4:34894832-34894854 ACACATATGCAACAAATGTTTGG + Intergenic
972728196 4:41764984-41765006 ACACATAAGCAAAAACTCTAAGG - Intergenic
972789575 4:42357992-42358014 ACACAGATGCAAGAACTGACAGG + Intergenic
972998307 4:44911686-44911708 ACACATATGATAAAGTTGTATGG + Intergenic
973092963 4:46160922-46160944 ACAAACATGCAAATATTGAAAGG + Intergenic
974752560 4:66159945-66159967 GCAAACATGCAAAAATTGTAGGG + Intergenic
975382052 4:73712006-73712028 ACAGAGAAGCAAAAATTCTAAGG + Intergenic
975756392 4:77575863-77575885 ACATATATTCCAAAATTGTATGG + Intronic
976164220 4:82236876-82236898 ACACAGATGCAAATATCCTAAGG + Intergenic
976495453 4:85724470-85724492 ACACACATGGAAAAATTATAAGG - Intronic
976940003 4:90688206-90688228 CAGCAGATGCAAAAATTCTAAGG - Intronic
977270758 4:94915250-94915272 ACAAAGAAGAAAAAAATGTAAGG - Intronic
977371823 4:96147017-96147039 ACACAGATGCAAGAAATGTTTGG - Intergenic
979649215 4:123110288-123110310 ACATAGTTGCAAAATTGGTAAGG + Intronic
980244098 4:130215543-130215565 ACACAGATGCAACATATATAGGG + Intergenic
980387256 4:132102326-132102348 AAACAGATGCAAAAATGCAAAGG + Intergenic
980389932 4:132131052-132131074 AAAAAGATGGAAAAATTCTATGG + Intergenic
980837147 4:138209454-138209476 ACACAGATGGTAAAATTATGTGG - Intronic
981283475 4:142988333-142988355 ACACAGAGGCTGAAATTGGAAGG - Intergenic
981843042 4:149134476-149134498 AGTCAGATGAAAAAATTATATGG - Intergenic
982044200 4:151425886-151425908 ACACATATACTAAAATTGGAGGG + Intronic
983108126 4:163715588-163715610 ACCCAGATGCAAAAATCTGAAGG + Intronic
983972040 4:173887500-173887522 ACACTGATGCAAAAATCCTCAGG - Intergenic
984188367 4:176574438-176574460 ACAGAGATGCAAACAGTGTTAGG + Intergenic
984899635 4:184573643-184573665 ACCCAGAGGCAGAAATTGCAGGG + Intergenic
985435326 4:189925333-189925355 ACAAAGATGCAAACATTCAATGG + Intergenic
986349021 5:6859715-6859737 ACACAGAGGCAGAAATTGGAGGG - Intergenic
986493232 5:8315499-8315521 ACACAGATTCAAAAATTCTGAGG + Intergenic
986658387 5:10037510-10037532 AAACAGAGGCAGAAATTGGAGGG + Intergenic
987615033 5:20262473-20262495 ATACATATGCATAAATTCTAAGG + Intronic
988392888 5:30658728-30658750 GGCCAGATGCAAAAATTCTAAGG - Intergenic
988627114 5:32889115-32889137 ACAAAGATGCAAATATTTGAGGG - Intergenic
989059557 5:37396978-37397000 ACAAAAATGCAAAAATTAGACGG + Intronic
989692063 5:44156409-44156431 ACATATCTGCCAAAATTGTATGG + Intergenic
989951515 5:50303785-50303807 ACAGAAATGCAAAAATTGTTTGG + Intergenic
991287021 5:64989085-64989107 GCACAGTTGCAAAAAGTGCATGG - Intronic
991396309 5:66208592-66208614 ACACAGAGGAAAAAATGGCAAGG + Intergenic
993255563 5:85586649-85586671 AAACAGAAGAAAAAATTTTAAGG - Intergenic
993347082 5:86797648-86797670 ACACACATGCAATAAAAGTATGG - Intergenic
994152183 5:96460286-96460308 ACACAGAGAGAAGAATTGTAAGG + Intergenic
994403363 5:99311706-99311728 AAATAGATGAAAAAATTGAAGGG - Intergenic
994961411 5:106608886-106608908 TCACAGATGTTCAAATTGTATGG + Intergenic
995085859 5:108108680-108108702 ACACAGATCCAGGATTTGTAAGG - Intronic
995425583 5:112018794-112018816 ACAAAGATGGAAAACTTTTAAGG - Intergenic
995546562 5:113238150-113238172 ACTCAGATGCAAAAATTACCAGG + Intronic
995635186 5:114180401-114180423 ACACAGAGGCAAGAAATTTAAGG - Intergenic
996262621 5:121492119-121492141 ACACAGAAGCAGAAAGTGAAAGG - Intergenic
997176938 5:131788538-131788560 ACACAAATACAAAAATTTTTGGG + Intronic
997831872 5:137157377-137157399 ACTCAGATGCAAAAATTCAAAGG - Intronic
999079534 5:148829822-148829844 ACACACAGGCAAAAATAGAAAGG - Intergenic
999574955 5:152965678-152965700 ACACAGATGAAGAACTTGCAAGG + Intergenic
1000617278 5:163441274-163441296 ATACAGTTGCAGAAATTGAAAGG - Exonic
1002803969 6:553616-553638 ACACAGATGCAGACAGTATATGG + Intronic
1002921045 6:1573682-1573704 ACAAAAATGCAAATATTGAACGG + Intergenic
1003247471 6:4396078-4396100 AAACATATGAAAAAAATGTATGG + Intergenic
1003483888 6:6557858-6557880 CCACAGATGATAAAAATGTATGG - Intergenic
1003727850 6:8786136-8786158 ACACAGATGCATAATTTGAAAGG + Intergenic
1003938532 6:11000738-11000760 AAACAGATGCATAAATTTTTTGG - Intronic
1004135567 6:12962676-12962698 ACAGAGCTGCAAAACTTGTTAGG - Intronic
1004904186 6:20221040-20221062 ACACAGATGCTAAATGTGGATGG - Intergenic
1004983047 6:21047700-21047722 AAACAGATGTAAAAAATGTCAGG + Intronic
1005416640 6:25606779-25606801 ACACCAACGCAAAAATAGTATGG - Intronic
1005532892 6:26725335-26725357 ACATAAAAGCAAAAATTGCAAGG + Intergenic
1005537903 6:26776329-26776351 ACATAAAAGCAAAAATTGCAAGG - Intergenic
1006059197 6:31407213-31407235 ACACTGATGCAAAAAATTGAAGG - Intronic
1006574512 6:35034907-35034929 ACCCAGATGCAAAAACTTAAAGG + Intronic
1006583866 6:35092720-35092742 ACACAGAGGCAGAATGTGTAAGG - Intergenic
1008184803 6:48375814-48375836 GAACAGAGGCAAAAATTGCAGGG - Intergenic
1008446330 6:51596153-51596175 CCACAGATGCAACAATTAAATGG - Intergenic
1008765921 6:54914935-54914957 ACAAATATGCTAAAACTGTAGGG - Intronic
1009006598 6:57796283-57796305 ACATAGAAGCAAAAATTGCATGG - Intergenic
1009008771 6:57818735-57818757 ACATAGAAGCAAAAATTGCATGG - Intergenic
1009274449 6:61657317-61657339 ACACAGATGGGAAAATAGTACGG - Intergenic
1009448701 6:63775427-63775449 ACACAGAAGCACCAATTTTATGG - Intronic
1009670444 6:66741633-66741655 ATACAGATGTAAAAATATTAAGG + Intergenic
1009713916 6:67362734-67362756 ACACAGTTACAAAAATATTATGG - Intergenic
1010011819 6:71056486-71056508 ACTCTGATACTAAAATTGTAAGG + Intergenic
1010080890 6:71860761-71860783 ACACAGATGCAAATATCCTCAGG - Intergenic
1010857838 6:80864423-80864445 AAATAGATGCAATAATAGTAAGG + Intergenic
1011400843 6:86959744-86959766 ACAGAGATTCAAAATTTGTCAGG - Intronic
1012488284 6:99746690-99746712 AGACAGATACAAAATATGTAAGG - Intergenic
1012645539 6:101674754-101674776 TAACAGCTGCAAAAATTGCATGG - Intronic
1013140817 6:107332710-107332732 AAACAGATTCAAAAATTTTGAGG - Intronic
1013534293 6:111049487-111049509 TCACAGAAATAAAAATTGTAAGG - Intergenic
1013748995 6:113379368-113379390 ATACAGTTGTAAAAATTGCAGGG - Intergenic
1013819879 6:114142097-114142119 ACACAAATGGAAAAATTTAAAGG - Intronic
1014400450 6:120982976-120982998 ACACAGTTGGAAAAAGTATAAGG + Intergenic
1014668095 6:124264705-124264727 ACAAAAATGCAAAAATGATAAGG - Intronic
1015023518 6:128505558-128505580 ACAAAGTTGCAAATATTGTAAGG + Intronic
1015125952 6:129754864-129754886 ACACATATGCAACAGTTGGAAGG + Intergenic
1015488921 6:133802973-133802995 ACACAGTTGATAAAAATGTAAGG - Intergenic
1015564318 6:134551771-134551793 ACACACACAAAAAAATTGTAAGG + Intergenic
1015896107 6:138018490-138018512 GCACAGATGTAAAAAATGCATGG + Intergenic
1015901144 6:138069090-138069112 CCACAGAGGCAAATACTGTAAGG + Intergenic
1016051172 6:139532083-139532105 ACACAGAAGCAACAATTCAAAGG - Intergenic
1016096030 6:140038428-140038450 ACACATATGCATAAAATATAAGG - Intergenic
1018516196 6:164582245-164582267 ACAGAGATGCAGAACTTGTTGGG - Intergenic
1021183863 7:17539637-17539659 ACACAGTGGCAAAGATTGAAAGG + Intergenic
1021426884 7:20510353-20510375 ACACAGATGCAAATAACATATGG - Intergenic
1021670440 7:23030353-23030375 ATAAACATACAAAAATTGTAGGG - Intergenic
1023551423 7:41374069-41374091 ACACAAATGCTAAAAATCTAAGG - Intergenic
1024780633 7:52843893-52843915 ACACAGATGCAGAAGTTGAAAGG + Intergenic
1025074833 7:55933864-55933886 AAAAAGATGCAAAAATTATCTGG - Intronic
1025113228 7:56236791-56236813 AGACACATGGAAGAATTGTATGG - Intergenic
1026527724 7:71169883-71169905 ACTCACATACAAAAAGTGTAGGG - Intronic
1027608983 7:80335689-80335711 ACATAAATGCAAACATTGTAAGG - Intergenic
1028230021 7:88295904-88295926 ACTTAGAGGAAAAAATTGTAAGG - Intronic
1028325521 7:89519725-89519747 ACACAGATGCCAAAATCCAATGG + Intergenic
1028428930 7:90723848-90723870 ACACAGATGCAAAAAATTACTGG - Intronic
1028851349 7:95541632-95541654 ACAAAGATGCAAAAATTAATTGG - Intergenic
1030278045 7:107741064-107741086 GCACAGATGTGAGAATTGTATGG - Intergenic
1030782757 7:113622546-113622568 ACACACATACAAAGATTCTATGG + Intergenic
1031463946 7:122085145-122085167 AAACTGATGCACAAATTGGATGG + Intronic
1033294589 7:140119779-140119801 ACACAGATGCATAGCTTCTAGGG + Intronic
1033718185 7:144025122-144025144 ACACAGCATCAAAAAATGTAGGG - Intergenic
1035551407 8:530169-530191 TCTCAGATGCAGAATTTGTATGG + Intronic
1038839124 8:31162907-31162929 ACATAGATGGTAAAATTTTATGG + Intronic
1039239992 8:35545803-35545825 ACATAAATACAAAAATTGTTGGG - Intronic
1039404404 8:37300269-37300291 AGACTGATTCAAAAATTGTTGGG + Intergenic
1040896191 8:52370848-52370870 ACACACATGCAAAAATTAATTGG - Intronic
1042711719 8:71724797-71724819 ACACAGTTGAAAAATTGGTAAGG + Intergenic
1043505790 8:80900606-80900628 ACAAAGAAACAAAAAATGTATGG + Intergenic
1044141107 8:88654370-88654392 CCACAGATGACAAAATTCTAAGG - Intergenic
1044762240 8:95533149-95533171 ATATAGATGCAAACATTCTACGG + Intergenic
1045627871 8:104077623-104077645 ACACAGATGTATAAATTATGTGG - Intronic
1046430950 8:114126722-114126744 CCACTGATCCACAAATTGTAGGG - Intergenic
1046721735 8:117627847-117627869 AAACAGATGCATAATTGGTAGGG + Intergenic
1046988636 8:120422490-120422512 AAACAGATGGAAAATTTATATGG - Intronic
1049129471 8:140825050-140825072 TCCCAGATGCAAAGGTTGTAAGG + Intronic
1050372844 9:4939520-4939542 ACAAAGATGCAAAGATGGTCAGG - Intergenic
1050804683 9:9659227-9659249 ACACATATGTAAAATTTTTAGGG - Intronic
1050978427 9:11973318-11973340 AGACGGTTGCAAAAATTGTGAGG + Intergenic
1051494441 9:17703533-17703555 ACATAGATGCAAAAATCCTCAGG + Intronic
1052520030 9:29534911-29534933 ACATAGATGCAAAAATCCTCAGG + Intergenic
1052723149 9:32197056-32197078 ACACTGATGAAAAAAATGGAAGG - Intergenic
1055033366 9:71792811-71792833 ACATAGATACAAAAATTATTTGG + Intronic
1055889084 9:81103692-81103714 TCACAGATGGAAAAACTGTTCGG - Intergenic
1057461996 9:95271449-95271471 AGACAGAAGCAAAGATTGGAGGG + Intronic
1058181272 9:101803090-101803112 AGGCAGATGCAAAAATAGTGGGG + Intergenic
1058327139 9:103712760-103712782 ACACATATACAAATATGGTATGG - Intergenic
1061123883 9:128661454-128661476 ACAAAAATACAAAAATTATACGG + Intergenic
1061469326 9:130810805-130810827 ACACAGATCCAAGAATTTCAAGG + Intronic
1187891697 X:23942244-23942266 ACATAGCTGCAAAAAATGTTGGG - Intergenic
1187898264 X:24002956-24002978 ACAGAGTTGTAAAAATTCTAAGG - Intronic
1188207546 X:27379087-27379109 TCACAGATGCAAAATATGAATGG + Intergenic
1189395876 X:40622519-40622541 AGACAGATGCTAAAATGTTAAGG + Intergenic
1189498942 X:41536268-41536290 ACAAAAATACAAAAATTGTCTGG - Intronic
1190458756 X:50650194-50650216 ACAGATATGCAAATATTGAAAGG + Intronic
1193646538 X:84076386-84076408 ACACAGATGCAAAAATTGTAAGG + Intronic
1193723020 X:85008761-85008783 AAACAATTGCAAAATTTGTATGG - Intronic
1194763845 X:97826292-97826314 ACACAGATGCTTACAGTGTAGGG - Intergenic
1195053447 X:101120083-101120105 ACATACATGCAAATATTGAAAGG + Intronic
1196630569 X:117934501-117934523 ATACAGAAGCAAAGATTATATGG + Intronic
1197573867 X:128183381-128183403 ACATACATGCACATATTGTATGG + Intergenic
1197647629 X:129035198-129035220 ACACAGATGCACACATAGCAAGG + Intergenic
1197803632 X:130378064-130378086 ACACATCTGCAAAAATACTAAGG + Intergenic
1197900627 X:131367919-131367941 ACATAAAAGCAAAAATTGTTTGG + Intronic
1198574709 X:137997535-137997557 ACATTGATGCAAAAAATGAATGG + Intergenic
1198616567 X:138464093-138464115 AAAAAGATGCAAAAAGTGAAGGG + Intergenic
1199245232 X:145596885-145596907 AGACAGATGCAAAAATCCTCAGG + Intergenic
1199506794 X:148571502-148571524 AAACAGATGGAAAAGCTGTATGG + Intronic
1199890105 X:152070716-152070738 AAGTAGATGCAAAAATTTTAGGG + Intergenic
1200366220 X:155667500-155667522 GCACAGAGGCAGAAAGTGTAGGG + Intronic
1200898433 Y:8402094-8402116 ATACATGTTCAAAAATTGTATGG + Intergenic
1200921033 Y:8613608-8613630 ACACAGCCTCAAAAATTGTCAGG + Intergenic
1201055748 Y:9988848-9988870 AACCATATGCAAAAAGTGTAAGG - Intergenic
1201393205 Y:13520968-13520990 ATATAGATGCAAAGATAGTAGGG + Intergenic