ID: 1193646638

View in Genome Browser
Species Human (GRCh38)
Location X:84078419-84078441
Sequence GACTCAATCATTCTGCTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 4, 3: 11, 4: 210}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193646638 Original CRISPR GACTCAATCATTCTGCTCAT AGG Intronic
901378026 1:8853782-8853804 GACCCAACAATTCTACTCATAGG + Intergenic
903676077 1:25065478-25065500 GACACAATCTCTGTGCTCATAGG + Intergenic
904496484 1:30889826-30889848 GACTCAGTAATTCTACTCCTAGG + Intronic
905747541 1:40431670-40431692 GACCCAACAATTCTACTCATAGG + Intergenic
910403366 1:86858763-86858785 GACTCAATAATTCCACTCCTAGG + Intergenic
914909764 1:151775482-151775504 GACTCACTCATTGTGCTGACTGG - Exonic
916308362 1:163365701-163365723 GACTCCATAATTCTACTCTTCGG - Intergenic
916325261 1:163549697-163549719 GATTCAGTCATTCTACTCCTAGG - Intergenic
917615046 1:176734060-176734082 GACTCTGGCATTCAGCTCATTGG - Intronic
919702617 1:200646729-200646751 GACTCAGTAATTCTATTCATAGG + Intronic
920393526 1:205626777-205626799 GACTCAACAATTCTACTCCTAGG + Intronic
921345668 1:214182447-214182469 GACTCAGTCATTCTCTTCCTAGG - Intergenic
923946303 1:238891793-238891815 TACTCATTCATACAGCTCATGGG - Intergenic
1069482572 10:68797141-68797163 GACTCAAGCATTCTGCTCCTTGG - Intergenic
1073067166 10:100769065-100769087 GACTGACTCATTCTACTCAATGG + Intronic
1075592230 10:123700757-123700779 GACTCAATAACTCTACTCCTAGG + Intergenic
1076448294 10:130534256-130534278 GATTCAGTCATTCCACTCATAGG - Intergenic
1077907716 11:6546892-6546914 GCCTCAGGCATTCTGCTCCTGGG + Exonic
1078435794 11:11324278-11324300 GACTCAGGAATTCTGCTCCTGGG + Intronic
1078754417 11:14195522-14195544 GTCTCAAGTATTATGCTCATGGG - Intronic
1079803642 11:24901784-24901806 ACCTCCATAATTCTGCTCATTGG + Intronic
1079955701 11:26861974-26861996 GACACAATCACTGTTCTCATTGG + Intergenic
1083410975 11:62492128-62492150 GACCCAGTCATTCTCCTCAAGGG + Intronic
1084135661 11:67178915-67178937 GACTTAACAATTCTGCTCCTAGG - Intronic
1084952390 11:72673932-72673954 GACACCCTCATTCTGCTCAGAGG + Intronic
1085121886 11:73972715-73972737 GTCTCATTCATTCTGATCACAGG - Intergenic
1086207889 11:84281993-84282015 GATTTAATGATTCTGCTCCTAGG + Intronic
1087765318 11:102145838-102145860 TGCTCACTCATTTTGCTCATTGG + Intronic
1091023606 11:132122908-132122930 GACTCACTCATTCATCTAATTGG + Intronic
1092438690 12:8476790-8476812 TACTCACTCATTTTGATCATGGG - Intronic
1094289601 12:28832392-28832414 GACTTAAACATTCTCCTCTTAGG + Intergenic
1097807166 12:63978718-63978740 GACTCAGCCATTCTGCTCCTAGG - Intronic
1099153078 12:79139824-79139846 GACTCACTCATTCTGCTCAGTGG - Intronic
1099412478 12:82348292-82348314 GTCTCAGTCATTCTACTCCTAGG + Intronic
1101856847 12:108450949-108450971 GAATCAATCACTCTGCCCAGAGG + Intergenic
1105892445 13:24691182-24691204 GACTCCATCATCTTCCTCATTGG + Exonic
1106206618 13:27602688-27602710 GACTCAACCCTTCTACTCTTAGG - Intronic
1108314527 13:49224399-49224421 GCCACAGTCCTTCTGCTCATGGG + Intergenic
1110349617 13:74492095-74492117 GACCCAATGATTCTACTCTTAGG - Intergenic
1110757934 13:79197966-79197988 GACTCAATCATTTTCACCATTGG - Intergenic
1110989042 13:82013352-82013374 GACACAAACATTCAGCCCATTGG - Intergenic
1113020701 13:105883722-105883744 GAGTAAATCATTATGTTCATTGG + Intergenic
1113367946 13:109695301-109695323 GACTCAACAATTCTGCTCCTGGG + Intergenic
1114236675 14:20830051-20830073 GACTCAATGCTTGTGTTCATAGG - Intergenic
1114305761 14:21421544-21421566 CACTCAATGATTCTGCACCTAGG - Intronic
1114401811 14:22417222-22417244 GACTGAAGCATTCTGCTTCTGGG - Intergenic
1114428437 14:22640101-22640123 GACCCAATAATTCTACTCCTAGG + Intergenic
1117199998 14:53380327-53380349 GATTCAGTGATTCTGCTCCTAGG + Intergenic
1117412699 14:55465503-55465525 GAAGCAATCATTCTTCCCATGGG - Intergenic
1117789179 14:59320938-59320960 GACTCAATAATTCTGCTCCTCGG + Intronic
1117855028 14:60021006-60021028 GACCCAACCATTCCACTCATAGG - Intronic
1118471528 14:66079312-66079334 GACTCACTTATTTTCCTCATCGG - Intergenic
1119525602 14:75320207-75320229 GACTCTGCCATTCTGCTCCTAGG - Intergenic
1120973250 14:90227082-90227104 GACTCACTCATTCTACTTCTAGG + Intergenic
1121854819 14:97258212-97258234 GACCCAACCATTCTACTCCTAGG + Intergenic
1122400413 14:101464107-101464129 GACCCTATCACTCTGCACATTGG + Intergenic
1122430836 14:101641662-101641684 GACCCAACAATTCTGCTCCTAGG + Intergenic
1123143566 14:106106990-106107012 GACTCAATCTCTTTACTCATTGG + Intergenic
1123191642 14:106577774-106577796 GACTCAATCTCTTTACTCATAGG + Intergenic
1124181374 15:27478623-27478645 GACTCAACAATTCTACTCCTAGG + Intronic
1124972792 15:34506012-34506034 GATTCCATAATTGTGCTCATTGG - Intergenic
1125159966 15:36631768-36631790 GACCCAGTAATTCTTCTCATAGG - Intronic
1126746778 15:51833817-51833839 GACTCAGTAACTCTGCTCCTAGG - Intronic
1129547434 15:76411640-76411662 GACTCAACAATTCTACTCTTAGG - Intronic
1129964116 15:79718557-79718579 AACTCCATCATTCTACTGATGGG - Intergenic
1131296611 15:91154918-91154940 TACTCAGTCATCCTGCTCACAGG - Intronic
1133872893 16:9706116-9706138 GACACAACCATTCTACTCCTAGG + Intergenic
1134640650 16:15827061-15827083 GACTCATTCATTCTCCTTTTAGG - Intronic
1136622570 16:31439371-31439393 GACTCAATAATTCTACTCTTAGG + Intronic
1138821036 16:60260274-60260296 GACTCAATAATTCTGTACAGTGG + Intergenic
1138971949 16:62155648-62155670 GACTCAACAATCCTGCTCTTAGG + Intergenic
1140632801 16:76873944-76873966 GGCTCTCTCATTCTTCTCATGGG - Intergenic
1141032746 16:80603910-80603932 TGCACAATCATTTTGCTCATTGG + Exonic
1141472402 16:84247965-84247987 GACTCAACAATTCTGCTCCTAGG + Intergenic
1141794407 16:86260477-86260499 TACTCAATTATTTTGCTAATAGG + Intergenic
1143725387 17:8841536-8841558 GACCCCTTCACTCTGCTCATTGG + Intronic
1144252545 17:13433015-13433037 GTCCCAACCATTCTGCTCCTAGG - Intergenic
1148660029 17:49322938-49322960 GAATCAATCATTTTGCCGATGGG + Intronic
1149333663 17:55611626-55611648 GACCCAGTCATTCTGCTTTTAGG + Intergenic
1150272907 17:63878116-63878138 GAGTCAATTACTCGGCTCATTGG + Intronic
1150939208 17:69671855-69671877 ATCTCAATCATTGTGCTCAGTGG - Intergenic
1151242976 17:72772504-72772526 GGGTCAGTTATTCTGCTCATGGG - Intronic
1152702939 17:81828482-81828504 GACCCAGCCATTCTGCTCCTAGG + Intronic
1153140339 18:1965019-1965041 GACTAAACCATTCTGCCTATTGG - Intergenic
1154058665 18:11036777-11036799 TACTGAATTATTCTCCTCATGGG + Intronic
1155619703 18:27764240-27764262 GACTTAATCATTCCACTCAAAGG + Intergenic
1157351172 18:46887092-46887114 GATCCAATAATTCTACTCATAGG + Intronic
1157367646 18:47080545-47080567 GACCCAATAATTCTACTCATAGG - Intronic
1158160461 18:54477264-54477286 GACCCAGTCATTCTACTCCTAGG + Intergenic
1159210693 18:65317770-65317792 GCCAAAATCATTCTGCTCAGTGG + Intergenic
1164805513 19:31113282-31113304 GGCTCATTCATTCAGCTCACAGG + Intergenic
1164964012 19:32464444-32464466 GACTCAGTTATTCTGCATATTGG + Intronic
1166818694 19:45563058-45563080 GAGTCAGTCATTCTGCTTCTGGG + Intronic
930932968 2:56910862-56910884 TAGTCAATAATTCTCCTCATTGG + Intergenic
931677826 2:64715496-64715518 GACTCAATAAATATGCTCCTAGG + Intronic
931738287 2:65218434-65218456 GACTCAATAATTTTACTCCTAGG - Intergenic
932465369 2:71919918-71919940 GACTCAGTAATTCTACTCCTAGG + Intergenic
932533584 2:72565929-72565951 GACTCAACCATCCTGCTTCTGGG + Intronic
933837006 2:86253925-86253947 GACTTAATAATCCTGCTCTTGGG + Intronic
933994511 2:87658075-87658097 GGTTCAATCAGTCTGCTCCTGGG - Intergenic
936299347 2:111292838-111292860 GGTTCAATCAGTCTGCTCCTGGG + Intergenic
936739787 2:115491247-115491269 GACTGCATTATTCTGCTCATTGG - Intronic
937799761 2:126069625-126069647 GACTCAATGTTTCTACTCACTGG + Intergenic
938034117 2:128021657-128021679 GACCCAACCATTCTGCTCCTTGG - Intronic
938914011 2:135916372-135916394 AACTAAATCATTCTGCAAATAGG - Exonic
941399808 2:165016832-165016854 GACTCAATCACTGTGCAGATGGG - Intergenic
944638927 2:201702437-201702459 GACTCAATGGTTCTACTCCTGGG - Intronic
944734649 2:202551148-202551170 GATTCAATCATCCTACTCTTAGG - Intronic
945439022 2:209855997-209856019 AACTCAATAATTTTACTCATAGG - Intronic
945658023 2:212649419-212649441 CTCTCAATCATTTTCCTCATAGG - Intergenic
1169905345 20:10597482-10597504 GACACTATCATTCGTCTCATAGG - Intronic
1170476388 20:16719024-16719046 GGCTCAAGCATTCTCCCCATCGG - Intergenic
1171566042 20:26188880-26188902 TTCTCATCCATTCTGCTCATGGG - Intergenic
1174345480 20:49926113-49926135 GACTCAGCAATTCTGCTCCTAGG + Intergenic
1177638603 21:23817518-23817540 GACTCAGCAATTCTGCTCCTTGG - Intergenic
1177915796 21:27086999-27087021 AACTCAATCATTCTGATCTAGGG + Intergenic
1178554726 21:33579316-33579338 AACTAAAACAGTCTGCTCATAGG + Intronic
1178668455 21:34569188-34569210 GACTAAATAATACTGCTCAGAGG - Intronic
1181287161 22:21761293-21761315 CACTCATTCCTTCTGCTCTTGGG - Exonic
1181733475 22:24864292-24864314 GACCCAGCAATTCTGCTCATAGG + Intronic
1182814527 22:33148585-33148607 GACTCAACCATCTTGCTCCTGGG - Intergenic
950208657 3:11100137-11100159 GACCCAACAATTCTGCTCCTAGG - Intergenic
951829566 3:26910705-26910727 GACTCAATCCTTCTGATTATGGG - Intergenic
952038925 3:29238133-29238155 GACCCAATGATTCTACTCACAGG - Intergenic
952682255 3:36107208-36107230 GATTCAATCATTTTGGTCCTTGG + Intergenic
956974066 3:74559843-74559865 GACTCCATAATTCTGGTTATCGG - Intergenic
957366711 3:79234264-79234286 GAAAAAATCATTCTGCACATTGG - Intronic
958498553 3:94875789-94875811 GACACAAACTTTCTGCTAATTGG + Intergenic
958571274 3:95885382-95885404 GACTCAGTGACTCTGCTTATAGG + Intergenic
959850125 3:111075602-111075624 AACTCAATTATTCAGCACATTGG - Intronic
960116937 3:113904687-113904709 TACTCAAGCATGCTGCTCAGGGG - Intronic
961663998 3:128485230-128485252 AACTCAATCAGTCTGATCTTGGG - Intronic
961991840 3:131200457-131200479 GACTCAATAATTTTACTCCTGGG + Intronic
964259211 3:154815537-154815559 GACTTAAAAGTTCTGCTCATTGG + Intergenic
964554547 3:157921906-157921928 TGCTCAATTATTCTACTCATTGG - Intergenic
965420086 3:168447346-168447368 GACTCCCTCACTCTGCTCGTTGG - Intergenic
967324670 3:188227415-188227437 GACTCTTCCAGTCTGCTCATAGG - Intronic
967637519 3:191820753-191820775 GATTCACTCATTCTCCTCTTTGG + Intergenic
971032582 4:22656840-22656862 GACTTAATTATTCTACTCTTAGG - Intergenic
972493232 4:39608134-39608156 GACTCAACAATTCTACTCATAGG + Intronic
972932126 4:44085032-44085054 GACCCCATCCTCCTGCTCATAGG - Intergenic
972934735 4:44119486-44119508 GACTCACTCCCTTTGCTCATTGG - Intergenic
973790429 4:54373144-54373166 GACTCAGCAATTCTGCTCCTAGG + Intergenic
974703027 4:65475668-65475690 TGTTCAATCATTCTTCTCATTGG - Intronic
975481476 4:74885409-74885431 GACTCCTTCACTCTGCCCATTGG - Intergenic
976141547 4:81998469-81998491 GACTCACTCATTCTGCCCATTGG - Intronic
977962369 4:103100536-103100558 TACACAATCACTCTGCTCACTGG - Intergenic
978064629 4:104381223-104381245 GACCCAAACATTTTGCCCATAGG - Intergenic
978785329 4:112602510-112602532 GACTCAATGATGCTACTCCTAGG + Intronic
978811736 4:112856889-112856911 GACCCCCTAATTCTGCTCATTGG - Intronic
980527496 4:134011802-134011824 GACTCAATCATTCTGTATTTAGG + Intergenic
982214809 4:153072128-153072150 GACTCAGACATTCTACTCCTAGG - Intergenic
983966330 4:173816726-173816748 GACTCAAGAATTCTACTCCTAGG + Intergenic
984988114 4:185351208-185351230 GCCCAAATCACTCTGCTCATGGG - Intronic
985155767 4:186985677-186985699 AACTCAATCATTCCTCTTATAGG - Intergenic
986719724 5:10552559-10552581 GACTCAGTCATTCCACTCCTGGG - Intergenic
987183824 5:15394378-15394400 GACTCAGTCATTCTACTCCCTGG - Intergenic
987688423 5:21235133-21235155 GACTCAATCATTCTGTCTTTAGG - Intergenic
987884380 5:23794664-23794686 GACTTACTAAATCTGCTCATGGG - Intergenic
987933149 5:24428233-24428255 GACCCATTCATTCTTCTTATTGG + Intergenic
988363589 5:30267385-30267407 GACACAAACATTCAGATCATAGG - Intergenic
989737568 5:44727268-44727290 CACTCAATCACTTTGCTCACAGG - Intergenic
990347320 5:54883670-54883692 GAATCATTCATTCTGCTCGTAGG + Intergenic
993414405 5:87608889-87608911 GACAGAATCATTCTGCACTTGGG + Intergenic
994708782 5:103240356-103240378 GACACAGTCATTCTACTCCTAGG + Intergenic
995304990 5:110635160-110635182 GATTCAATCTTGCTACTCATTGG - Intronic
997123850 5:131205537-131205559 GACTCAACAGTTCTGCTCCTTGG - Intergenic
998363524 5:141612282-141612304 GACCCAGTCATTCCACTCATGGG + Intronic
998916704 5:147020626-147020648 GACTGTATCTTTCTGCTTATAGG + Intronic
999846568 5:155487816-155487838 GACTCAGTAATTCTACTCTTGGG - Intergenic
1000702180 5:164466534-164466556 GACTCCATCATCCTGATAATAGG - Intergenic
1004033107 6:11892297-11892319 GACTTAAGAATTCTGCTCCTAGG - Intergenic
1004535640 6:16498502-16498524 GACTCAGTAGTTCTGCTCTTAGG - Intronic
1005429834 6:25743945-25743967 GACTCAAATATTCTTCTCCTTGG - Intergenic
1007749220 6:44061993-44062015 GACTCACTGATTCTGCTTCTGGG + Intergenic
1013665783 6:112346907-112346929 GACTCAACAATTCTACTCTTAGG - Intergenic
1014143241 6:117967729-117967751 AACTTAATTATTCTGCTCCTTGG + Intronic
1016076935 6:139806385-139806407 GACTCAGAAATTCTGCTCTTAGG - Intergenic
1018269547 6:162062042-162062064 GACTCAGTTATTCTACTCTTAGG + Intronic
1019267506 7:126556-126578 GACTCAACAATTCTGCTCCTAGG - Intergenic
1019385287 7:752080-752102 GACGCTCTCGTTCTGCTCATCGG - Intronic
1022844189 7:34193445-34193467 GACTCAATGATTTCGCTAATGGG + Intergenic
1023038153 7:36151078-36151100 GACTCAACCAATCTACTTATAGG - Intergenic
1024087349 7:45905829-45905851 GACCCAACAATTCTGCTCCTGGG + Intergenic
1024423815 7:49202294-49202316 GACTCAATCAATCTGATCCCTGG + Intergenic
1025271439 7:57523126-57523148 ATCTCATCCATTCTGCTCATGGG + Intergenic
1030414620 7:109227256-109227278 GACTGGATTTTTCTGCTCATTGG - Intergenic
1031198366 7:118645602-118645624 GACACAATAATTCTACTCTTAGG + Intergenic
1032910654 7:136425564-136425586 GACTCAGTAATTCCACTCATAGG - Intergenic
1034524107 7:151644699-151644721 GACTCAGCCATTCTACTCCTTGG - Intronic
1034729535 7:153373880-153373902 GACTGAATAATTCTACTCTTAGG + Intergenic
1035543693 8:462012-462034 GACTCAGCCATTCTACTCCTAGG - Intronic
1038695298 8:29801142-29801164 GACTCCATCTTTCAGCTCTTTGG - Intergenic
1039279730 8:35971126-35971148 GACTCAATCATTTCACTCCTAGG - Intergenic
1039678163 8:39695248-39695270 GACTCAGTAATTGTGCTCCTTGG - Intronic
1042495525 8:69451088-69451110 GACCCAATAATTCTTCTCCTGGG + Intergenic
1044846068 8:96383046-96383068 GAGCCAATCATTATGCTCAGAGG + Intergenic
1045323685 8:101101137-101101159 GAGTCAAGCATTTTGCTGATGGG - Intergenic
1047813557 8:128436861-128436883 CACTCAGTCATTCAGCTCAAAGG - Intergenic
1048482980 8:134818572-134818594 GATTCAGTCATTCTACTCCTAGG + Intergenic
1049069817 8:140347626-140347648 GACCCCCTCACTCTGCTCATTGG + Intronic
1051111901 9:13648832-13648854 GACTGAATCATTCTGTGGATTGG + Intergenic
1051268157 9:15328701-15328723 GACTCAGCAATTCTGCTCCTAGG + Intergenic
1051763619 9:20497822-20497844 TACCCAATCATTCTGCTTGTAGG - Intronic
1052744433 9:32426339-32426361 AACTCAATCCTGCTGCTCAGGGG - Intronic
1053038005 9:34842349-34842371 GATTCAGTCATTCTACTCCTGGG - Intergenic
1054713454 9:68534311-68534333 TACTCAAACTTTCTGCTCAAAGG + Intergenic
1056890953 9:90491800-90491822 CACAGAATCATTCTGCTCTTAGG - Intergenic
1058859846 9:109105479-109105501 GACCCAGTAATTCTACTCATAGG + Intronic
1059394011 9:114019356-114019378 GACCCAGTCATTCTACTCCTTGG - Intronic
1059749505 9:117234708-117234730 GACTCTTTCATTCTGCACAAGGG + Intronic
1060061288 9:120462405-120462427 GACTCAGGAATTCTACTCATAGG + Intronic
1187014303 X:15310316-15310338 GACTCAATCATTCTCTTCTAAGG + Intronic
1188643244 X:32533235-32533257 GACTTAAACCTTCTGGTCATGGG - Intronic
1189302563 X:39962765-39962787 GACACAAACATTCAGCCCATAGG + Intergenic
1189639801 X:43056026-43056048 GACTTCCTCATTCTTCTCATTGG - Intergenic
1190034783 X:47011548-47011570 GACTCAATAATTCTATTCCTAGG - Intronic
1191793071 X:64991649-64991671 GACTCATTAATTCTACTCCTAGG + Intronic
1193646638 X:84078419-84078441 GACTCAATCATTCTGCTCATAGG + Intronic
1193911506 X:87312211-87312233 GACCCAGTCATCCTGCTCCTAGG - Intergenic
1195084604 X:101402370-101402392 GACCCCCTCAATCTGCTCATTGG + Intronic
1195236172 X:102900683-102900705 GAATGAATCATTCTGCACTTAGG + Intergenic
1197254309 X:124246541-124246563 GACCCAGTGATTCTGCTCCTAGG - Intronic
1197531633 X:127635421-127635443 GACTCCCTCACTGTGCTCATTGG + Intergenic
1197787787 X:130217082-130217104 GACTCAGCCATTCTACTCAGAGG + Intronic
1199885318 X:152015486-152015508 GATTCAGCCATTCTGGTCATAGG - Intergenic