ID: 1193647898

View in Genome Browser
Species Human (GRCh38)
Location X:84090845-84090867
Sequence CCATTACTACAGAAACAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 249}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193647894_1193647898 17 Left 1193647894 X:84090805-84090827 CCAAAACATATCAGGTAATAAGG 0: 1
1: 0
2: 5
3: 40
4: 346
Right 1193647898 X:84090845-84090867 CCATTACTACAGAAACAAAGTGG 0: 1
1: 0
2: 3
3: 23
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193647898 Original CRISPR CCATTACTACAGAAACAAAG TGG Intronic
901926917 1:12571832-12571854 GTATTATTACAGAAACAATGTGG - Intronic
902452232 1:16504058-16504080 CCAGTTTTACAAAAACAAAGTGG - Intergenic
902500715 1:16909530-16909552 CCAGTTTTACAAAAACAAAGTGG + Intronic
902891761 1:19449223-19449245 CCAGGACAACAGGAACAAAGTGG + Intronic
904331823 1:29763527-29763549 CCATAACAACAGCAAAAAAGAGG + Intergenic
904624214 1:31793095-31793117 CCATTCCTACAGAGACAAACAGG - Intronic
907236872 1:53057661-53057683 CCATAAATTCAGAAACAAAAAGG - Intergenic
910248812 1:85172142-85172164 CTATTATTACAGAAAGGAAGTGG + Intronic
911095422 1:94051030-94051052 CCTTTACTACTGAACCAAACAGG - Intronic
911675295 1:100651911-100651933 CTATCACCACAGAAAGAAAGAGG - Intergenic
912984237 1:114410769-114410791 CCCTTACTACAAAAAAAAAAGGG + Intronic
913038876 1:115003954-115003976 TCATTACTACATAACCACAGTGG - Intergenic
913096137 1:115517377-115517399 ACATTAATTCAGAAACAAAAGGG - Intergenic
914004336 1:143719355-143719377 CCAGTTTTACAAAAACAAAGTGG - Intergenic
914095566 1:144541724-144541746 CCAGTTTTACAAAAACAAAGTGG - Intergenic
914302955 1:146392170-146392192 CCAGTTTTACAAAAACAAAGTGG + Intergenic
915851917 1:159333151-159333173 ACATTTTTACAGAAATAAAGTGG - Intergenic
916204499 1:162302096-162302118 ACAGTACTACAGGAACACAGAGG - Intronic
916682279 1:167115604-167115626 CCCTTACTACATATAAAAAGTGG - Intronic
918100972 1:181373888-181373910 ACATTAATAAAGAAAAAAAGAGG - Intergenic
918614967 1:186533607-186533629 CCATTTCTAAATAAACAAATGGG + Intergenic
919714991 1:200766894-200766916 CCTTTAATACAGGAACAGAGTGG - Intronic
919834611 1:201565261-201565283 TCATTACTACATAAACCATGTGG + Intergenic
921075319 1:211695941-211695963 CCACTGCTAAAGAAATAAAGCGG + Intergenic
924334822 1:242977016-242977038 CCAATACTATAGAGAAAAAGTGG + Intergenic
924363425 1:243264784-243264806 CTATGACTACAGACACAAACAGG - Intronic
924870334 1:248035835-248035857 CCCTTACTGCAGATATAAAGTGG - Intronic
1062861426 10:813398-813420 CCATTACTACAGTAGCACAGAGG - Intronic
1063253593 10:4301852-4301874 CTATTACTAAAGAAAGAAAACGG - Intergenic
1064349448 10:14563037-14563059 GAATTACTACTGAAATAAAGCGG + Intronic
1065515448 10:26519630-26519652 CCATTACTACTGTAACATAGCGG + Intronic
1065863477 10:29892183-29892205 CAATTACTACAGACAAAAATTGG - Intergenic
1065914903 10:30346406-30346428 CAATTACTACAGATAAAGAGAGG + Intronic
1066115458 10:32235093-32235115 CATTAACTACAAAAACAAAGAGG - Intergenic
1067568379 10:47354137-47354159 ACATTTTTACAGAAACAGAGGGG - Intronic
1068022400 10:51601690-51601712 CCATTATTTTAGAAATAAAGTGG + Intronic
1069122896 10:64589866-64589888 CCAGTAATACAGAAATAAATGGG - Intergenic
1070188903 10:74093413-74093435 TCATTATTAAAGAAACAAAATGG - Intronic
1070631441 10:78087807-78087829 CCAATATTTCAGAAGCAAAGAGG + Intergenic
1072186180 10:93041334-93041356 CATTTACTACAGAACCGAAGTGG + Intronic
1072267808 10:93747149-93747171 TCATTCCTACAGAAACCAATGGG + Intergenic
1073276210 10:102313816-102313838 GCATTAATACAGATACACAGAGG - Intronic
1074267622 10:111920584-111920606 ACATTTCTACAGAACCCAAGAGG + Intergenic
1074458289 10:113614281-113614303 CCTTTAGTACAAATACAAAGAGG - Exonic
1076646216 10:131956696-131956718 CTACTTCTACAGAAACACAGCGG - Intronic
1078667163 11:13335382-13335404 GCATTTCTACAGACAAAAAGAGG - Intronic
1079602980 11:22332801-22332823 CCATTAATGCAGAAATAAAAGGG + Intergenic
1080932936 11:36831965-36831987 CAATTACAACAAAAACAAAAAGG - Intergenic
1082899453 11:58229230-58229252 CTTTTACTAAAGAAATAAAGCGG - Intergenic
1084328665 11:68416737-68416759 CCATGACTACTTAAACAACGGGG - Intronic
1085015819 11:73173531-73173553 TCCTTCCAACAGAAACAAAGAGG - Intergenic
1085838327 11:79980529-79980551 AAATTACTATAGAAGCAAAGAGG - Intergenic
1085887953 11:80542740-80542762 CTATTAATAAAGAAACAAGGGGG - Intergenic
1089664802 11:120011545-120011567 CCATTACTATAGAAAGAAAATGG + Intergenic
1089683628 11:120133266-120133288 CCAATCCTACAGGAACAAAAAGG + Intronic
1089709110 11:120302306-120302328 CCCTTTCCACAGCAACAAAGCGG + Exonic
1091228256 11:133971097-133971119 CCATTTCTGCAGCCACAAAGTGG + Intergenic
1094125082 12:27014673-27014695 CCTTTACAACAGCAAAAAAGAGG + Intergenic
1095172146 12:39048453-39048475 ACATAAGCACAGAAACAAAGGGG - Intergenic
1095342294 12:41105669-41105691 CCATTCATAAAGAAACATAGAGG + Intergenic
1095786241 12:46111164-46111186 GCATTCCTACAGATAAAAAGAGG + Intergenic
1098182844 12:67866415-67866437 CCATTCCTTCTGAAACTAAGAGG - Intergenic
1100293328 12:93237489-93237511 CCAATGCTAAAGAAATAAAGAGG + Intergenic
1101125018 12:101624202-101624224 TCATTACTTCAGAATCCAAGAGG - Intronic
1103122165 12:118389332-118389354 CAATTACTCCAGAAACAGAGTGG - Intronic
1104567038 12:129894421-129894443 CCAGTAGAGCAGAAACAAAGAGG + Intronic
1105815500 13:24032586-24032608 CCATTACTGCAGAAACGACAGGG - Intronic
1108041513 13:46343820-46343842 CCATATCTAGAGAAACAATGTGG - Intronic
1108406453 13:50107929-50107951 CTATTACCACAGACACAAAAGGG - Intronic
1108726336 13:53185981-53186003 CAATTTCTACAAAAAAAAAGTGG - Intergenic
1109160199 13:58963426-58963448 CCATTACAACAGTGACAAATTGG + Intergenic
1109689575 13:65867954-65867976 ACATTACTACAGAGTTAAAGTGG - Intergenic
1109910725 13:68906846-68906868 CCATTACTCTAGAAATAAACTGG + Intergenic
1110518978 13:76451880-76451902 ACATTACTACAGAAACTCAAAGG + Intergenic
1112770323 13:102788281-102788303 CCATAAATACAGAAATAAAGAGG - Intronic
1113815187 13:113164702-113164724 CCAGTACTACAGAAGGAAGGAGG - Intronic
1113881951 13:113631965-113631987 CCACTACACCAGACACAAAGCGG - Intronic
1114491843 14:23107365-23107387 ACATTTCTACAGATAAAAAGTGG - Intergenic
1114821075 14:26019772-26019794 CCCTTACCACTGAGACAAAGAGG - Intergenic
1116410291 14:44613068-44613090 CATTTAAGACAGAAACAAAGGGG + Intergenic
1116424284 14:44770515-44770537 ACATTAAAACAGAAACAAACCGG + Intergenic
1116563679 14:46417119-46417141 ACTTTACTAGAAAAACAAAGTGG + Intergenic
1117965624 14:61204287-61204309 ACCTTACTAAAGTAACAAAGAGG - Intronic
1119082265 14:71706465-71706487 CCATTTCTACAGAAACATAATGG - Intronic
1119519635 14:75276728-75276750 CCTTGATTACAGAAAGAAAGAGG - Intergenic
1122155666 14:99748854-99748876 GCAAATCTACAGAAACAAAGTGG - Intronic
1124266824 15:28243369-28243391 CCATTAAAACAGAAACAAACTGG + Intronic
1124343234 15:28903422-28903444 CCCTTTCTGCAGGAACAAAGTGG - Intronic
1133571647 16:7046572-7046594 CAAAGACTACAGAAACAAAGAGG - Intronic
1134863338 16:17581192-17581214 CCATTTCCACAGAAAAAAAGAGG - Intergenic
1135380329 16:21990937-21990959 CCATTAAAACAGAAAAAAAAAGG - Intronic
1135902296 16:26473507-26473529 GCATTATTACAAAAATAAAGAGG + Intergenic
1136187319 16:28595973-28595995 CCATCACAACAGCAAGAAAGTGG + Intronic
1136189800 16:28608898-28608920 CCATCACAACAGCAAGAAAGTGG + Intronic
1136317186 16:29461321-29461343 CCATCACAACAGCAAGAAAGTGG - Intronic
1136431761 16:30200664-30200686 CCATCACAACAGCAAGAAAGTGG - Intronic
1138311812 16:56031152-56031174 ACATTATCAAAGAAACAAAGAGG + Intergenic
1143555051 17:7654797-7654819 CCATCACCATAGAAACAAGGGGG + Intronic
1148878922 17:50710332-50710354 GCATTACAATAGAAACAATGTGG + Intergenic
1151331812 17:73414532-73414554 CAATGACTTCAGAAACAGAGGGG + Intronic
1153196172 18:2599363-2599385 CCAGTACTATAAAGACAAAGAGG + Intronic
1155950049 18:31901975-31901997 CAAATACTACAGTGACAAAGAGG - Intronic
1156264918 18:35479094-35479116 CCATGACAACACAAACAAATAGG + Intronic
1157786346 18:50486590-50486612 CCATTGCAACAGAAACCAAATGG - Intergenic
1158089671 18:53695925-53695947 CCATTACTATGCAAACAAAAAGG - Intergenic
1162595017 19:11621785-11621807 CAATTAATACATAAACAAAAAGG - Intergenic
1165875888 19:39006637-39006659 CAATTCATACAGAAACAAGGAGG - Intronic
1166627244 19:44369607-44369629 GCATTACTACATAAACAATAGGG - Intronic
1168044087 19:53781567-53781589 CAATTACTATAGCAAGAAAGTGG + Intergenic
927116184 2:19904272-19904294 TCAATTCTACAGAAATAAAGAGG + Intergenic
927512725 2:23654548-23654570 CCATTACTACAAAGACCCAGGGG - Intronic
931813656 2:65879149-65879171 CTATTTCTAGAGAAACAAATAGG + Intergenic
932524567 2:72450341-72450363 CCATTAAATCAGAAACAGAGTGG + Intronic
933464061 2:82627580-82627602 ACATAATTACTGAAACAAAGTGG + Intergenic
934684047 2:96307346-96307368 CTACTTCTACAGAAACAGAGTGG - Intergenic
934868551 2:97838035-97838057 CTATTAATGCATAAACAAAGTGG - Intronic
934876772 2:97928807-97928829 CAATTTATACAGAAACAAGGCGG + Intronic
935254734 2:101299721-101299743 CCATTACCACACAAAGAACGTGG - Intronic
935519355 2:104084940-104084962 CCAGTAAAACAGAAAGAAAGGGG - Intergenic
936035915 2:109111141-109111163 CCATTAATCCAGAAATAGAGTGG - Intergenic
938546254 2:132334946-132334968 GCATTATTACAGAAACAATAGGG + Intergenic
939268349 2:139905104-139905126 CCATTACTACACTAACAAAAAGG + Intergenic
939305284 2:140402542-140402564 ACATTCCTACAGAGAAAAAGAGG + Intronic
939741095 2:145907363-145907385 CAATTACTAGAGATAAAAAGGGG + Intergenic
940986747 2:160058644-160058666 CAAGTACTCCAGATACAAAGTGG - Intronic
943413690 2:187571650-187571672 ACATAACTACTGAAACAGAGGGG - Intergenic
944513659 2:200489768-200489790 CGTTTACTTCAGCAACAAAGTGG + Exonic
944651309 2:201833023-201833045 CCATCACTACAGAAACTTACGGG - Intronic
946090636 2:217219696-217219718 CCATTAATAATGAAACAAGGAGG - Intergenic
946396038 2:219444232-219444254 CCAGTACCCCAGGAACAAAGAGG - Intronic
947690626 2:232132827-232132849 GCAGTCCCACAGAAACAAAGAGG - Intronic
1170447641 20:16445676-16445698 CCATTTTTACAGAACCAACGAGG + Intronic
1170729591 20:18961766-18961788 CAATTACCACAGAAATACAGAGG - Intergenic
1179934805 21:44595835-44595857 CCATGTTTACAGAAACATAGTGG - Intronic
1181871613 22:25903614-25903636 CTTTTGCTACAGAGACAAAGAGG - Exonic
1182031692 22:27163988-27164010 GCATTGTTACAGAAACAAACAGG - Intergenic
1185240101 22:49737769-49737791 CCATTCCCACATACACAAAGAGG + Intergenic
951770736 3:26254386-26254408 CTCTTACTACACAAACAAAAAGG - Intergenic
952417694 3:33104406-33104428 GCATGGCTACAAAAACAAAGAGG - Intergenic
952573896 3:34751085-34751107 CCAATTCTACAGAAACAAAAAGG + Intergenic
955385336 3:58474760-58474782 CCATATCTACAGGAACATAGTGG + Intergenic
957502810 3:81078644-81078666 CCATGACTACACAAATAAGGGGG + Intergenic
958703617 3:97624865-97624887 CCAATTCTACAGAAATAAAAAGG - Intronic
961989622 3:131173890-131173912 ACATTACAACATGAACAAAGTGG - Intronic
962545657 3:136431630-136431652 CCATTACCAGAGAAACAAAAAGG - Intronic
964695063 3:159498238-159498260 TAATTACTTCAGAACCAAAGGGG + Intronic
964865557 3:161255870-161255892 ACATTGCTACAGAAACATAGTGG - Intergenic
965297347 3:166965919-166965941 CCAATACCACAGAAACACAAAGG - Intergenic
965739645 3:171860816-171860838 CCATTCCTACCCCAACAAAGAGG + Intronic
966337280 3:178882542-178882564 CCAGAAGGACAGAAACAAAGGGG + Intergenic
966672623 3:182544925-182544947 CCATGACCACAGAAACAAAAAGG + Intergenic
966962912 3:184958370-184958392 ACATTTCTATAGAAACAAAAAGG + Intronic
967900477 3:194445711-194445733 TCATTATTACAGAAAAAAATGGG - Intronic
970337444 4:15063715-15063737 CTATAATTTCAGAAACAAAGAGG - Intronic
970570882 4:17381388-17381410 GCATAACTACAGATACAGAGGGG + Intergenic
971133654 4:23841526-23841548 TCATAAATACAGAAACACAGTGG + Intronic
975119598 4:70714068-70714090 CCATTTCTACATTAACAAAATGG - Intronic
976508859 4:85883588-85883610 ACATCATTACATAAACAAAGAGG + Intronic
976541241 4:86279609-86279631 CTTTTACTTCAGAAACAAAGTGG + Intronic
976804415 4:89029915-89029937 ATATTACTACAGTAACCAAGGGG + Intronic
978539344 4:109800025-109800047 CCATTTCTACAGAAACCAAAGGG - Intronic
979242292 4:118458261-118458283 CCAATACTATAGAGAAAAAGTGG - Intergenic
980677885 4:136113770-136113792 CCATTACTAGAGATAAATAGGGG + Intergenic
980969779 4:139557136-139557158 CCATTACCACAGCAGCAAGGAGG - Intronic
982116769 4:152104733-152104755 CCATTACTAAAGAAATGAAAGGG - Intergenic
983382646 4:167017239-167017261 CCATTTGTACAGTAACACAGAGG + Intronic
983409801 4:167381782-167381804 CCAATATTTCAGAAACAAAATGG - Intergenic
983873681 4:172851615-172851637 CCATTGCTACAGAAACAGTATGG - Intronic
984276261 4:177613745-177613767 ACATGATTACACAAACAAAGTGG - Intergenic
987246839 5:16057739-16057761 CCATCATTTCAGAAACAAAGAGG - Intergenic
988058948 5:26141265-26141287 ACATTAACACAGAAACAAAAGGG + Intergenic
988260755 5:28883431-28883453 CCATCACTGCAGAAACAACTGGG + Intergenic
988290684 5:29281620-29281642 TAAAAACTACAGAAACAAAGTGG - Intergenic
990492896 5:56319628-56319650 CCCGGACTGCAGAAACAAAGCGG + Intergenic
992847142 5:80761891-80761913 CCTTAACTACAGCAACATAGAGG + Intronic
992943267 5:81784044-81784066 CCATTACGAATGAAATAAAGAGG + Intergenic
993091026 5:83426696-83426718 CCAGGACTACAGAACCAAAAAGG + Intergenic
995187010 5:109281948-109281970 CCACTACAGCAGAAACAAATGGG + Intergenic
995754988 5:115493484-115493506 CCATTACTTAAGAAATAAACAGG - Intergenic
996139626 5:119890118-119890140 CCATTACTAAAGTAACACCGGGG - Intergenic
997380522 5:133433240-133433262 CCCTTACTTCAAAAACAAATAGG - Intronic
998139882 5:139693728-139693750 CCCTTAGTACACAAAAAAAGGGG - Intergenic
999679244 5:154040033-154040055 CCATTACAACAGAAAATCAGAGG - Intronic
1000205535 5:159054655-159054677 CTAAAAGTACAGAAACAAAGTGG + Intronic
1000518424 5:162269394-162269416 TAATAACTACAGAAACAAAATGG + Intergenic
1000842430 5:166237531-166237553 CCAATTCTACAGAAATAAAAAGG + Intergenic
1003850935 6:10221749-10221771 CTATTATTAGAGAAAGAAAGAGG + Intergenic
1004766862 6:18738985-18739007 TTTTTACTACAAAAACAAAGTGG + Intergenic
1004941753 6:20565999-20566021 CCATTTGTCCAGAAACAAAGGGG - Intronic
1007761636 6:44136731-44136753 CCATGACTACGGAAAAAAGGTGG - Intronic
1007797548 6:44362612-44362634 CCATTGCTCCAGAAATAAATAGG + Intronic
1009418642 6:63441878-63441900 CCATTATTCCGGACACAAAGGGG - Intergenic
1009958773 6:70493325-70493347 ACAGTAATACAGAAAAAAAGTGG + Intronic
1010529896 6:76955227-76955249 CCATTATTATGGTAACAAAGAGG - Intergenic
1010590986 6:77711721-77711743 CCTTTACAAGAGAAAAAAAGGGG - Intronic
1011394626 6:86892815-86892837 ACATTCCTACAGACAAAAAGAGG + Intergenic
1011949207 6:92943203-92943225 TCATTAAAGCAGAAACAAAGAGG - Intergenic
1012203393 6:96434313-96434335 ACATTCCTACAGAATAAAAGAGG - Intergenic
1012436557 6:99220706-99220728 CCATAACTACAGTAATAAAGTGG + Intergenic
1013258064 6:108409407-108409429 CCATTATTACAAAAATAAATGGG + Intronic
1013675210 6:112452212-112452234 CAAATCCTACAGAAATAAAGAGG - Intergenic
1016092083 6:139992539-139992561 CAGTTAATACAGAAACACAGAGG + Intergenic
1017689326 6:156947515-156947537 CCATTTCTACAAAATAAAAGGGG - Intronic
1017862573 6:158412814-158412836 CCACTACTACAAAAACAAAGAGG - Intronic
1018931205 6:168241604-168241626 CCATTTCTACAGGAGGAAAGGGG - Intergenic
1019888681 7:3927449-3927471 CCTTTACTACAGGAGAAAAGGGG - Intronic
1020494486 7:8831872-8831894 ACAACAATACAGAAACAAAGAGG - Intergenic
1021543663 7:21789206-21789228 GAATTAATACAGATACAAAGAGG - Intronic
1021769628 7:23985327-23985349 GCATTCCTACAGATAAAAAGAGG + Intergenic
1023142515 7:37116301-37116323 CAATTACAGCAGAAAGAAAGAGG + Intronic
1024276741 7:47683651-47683673 CCATTCCTTCAGCAACAATGGGG + Intergenic
1025870794 7:65432121-65432143 CCTTTACTCTAGAAGCAAAGAGG + Intergenic
1026792609 7:73344501-73344523 CAAATACTACAGAAAAAAAGGGG - Intronic
1027348738 7:77288688-77288710 GCATGAGTTCAGAAACAAAGAGG + Intronic
1028108482 7:86909348-86909370 CCAGGACTACAGAGACAAAAAGG + Intronic
1028259909 7:88650495-88650517 CCATTACCACAGAAATTTAGAGG + Intergenic
1029890450 7:103923978-103924000 CCATTAAAGCTGAAACAAAGAGG + Intronic
1029938022 7:104449167-104449189 GCATCACTACAAAAACAAATGGG - Intronic
1031321425 7:120334445-120334467 TCATTACTGCAGAAACATAGAGG - Intronic
1031904209 7:127442970-127442992 CCATTACAACAGGAACAAAGAGG - Intergenic
1032456574 7:132077535-132077557 CCAGAACTACAGACACAAGGAGG + Intergenic
1033040003 7:137909130-137909152 ACATTGCTCCAGAAACAAACCGG - Intronic
1034050858 7:147983075-147983097 TCATTGGTACAGAAACAACGTGG - Intronic
1035137231 7:156715851-156715873 CCATTACAACAGTAGCCAAGAGG - Intronic
1038405187 8:27316700-27316722 CCTAAACTACAGAAACAAGGAGG + Intronic
1039747921 8:40447867-40447889 TCATTGCTACAGAAACCATGTGG + Intergenic
1043334940 8:79163780-79163802 GCATTAGTACACAAACAGAGTGG - Intergenic
1043950051 8:86298793-86298815 TCATTACCACAGGAACATAGTGG + Intronic
1044393846 8:91685682-91685704 ACATTAAAACAGAAAAAAAGAGG + Intergenic
1045431120 8:102115956-102115978 CCTTTACTTCTGAAATAAAGGGG - Intronic
1046529564 8:115425922-115425944 ACATTATTACAGAAACAGCGTGG - Intronic
1047021187 8:120776454-120776476 CCATTTCTACAGACTCCAAGAGG + Intronic
1049282188 8:141755368-141755390 CCCTTTCTATAAAAACAAAGAGG - Intergenic
1050445772 9:5721226-5721248 CCATTAGTACCGAAACCATGTGG + Intronic
1051523039 9:18012048-18012070 CCATTTCTAGAGAAAGAAACAGG + Intergenic
1057200669 9:93138100-93138122 ACAGAACAACAGAAACAAAGTGG + Intergenic
1057384809 9:94597851-94597873 ACATCACTACAGAAATAGAGTGG + Intergenic
1057613210 9:96566053-96566075 CCATTAAAACAGAAGCAATGAGG + Intronic
1058010844 9:99975163-99975185 CTATTAGAACAGGAACAAAGAGG - Intergenic
1058771473 9:108237102-108237124 CCATTAACACAGAGATAAAGGGG + Intergenic
1062296266 9:135828957-135828979 GCAATACTTCAGAAACACAGAGG + Intronic
1186107351 X:6221927-6221949 CCATCATCACAGAACCAAAGAGG + Intronic
1186203211 X:7175062-7175084 CCATGGATACTGAAACAAAGGGG - Intergenic
1187532806 X:20112078-20112100 CTGTTATTACAGAAACACAGAGG + Intronic
1189009283 X:37030228-37030250 CCATTGCTACAGGAGCTAAGTGG + Intergenic
1189555022 X:42134074-42134096 CCATTTTTACAGAAACTGAGGGG - Intergenic
1190149156 X:47928219-47928241 CCAATGCTACAGATAAAAAGGGG - Intronic
1190594993 X:52043531-52043553 CCTTTCTTACAGGAACAAAGAGG - Intergenic
1190613831 X:52210542-52210564 CCTTTCTTACAGGAACAAAGAGG + Intergenic
1191682499 X:63855672-63855694 CCCTTTCTAGAGAAACAAAGGGG + Intergenic
1192035603 X:67559557-67559579 CCATTTCCACAGTAACAAAAAGG - Intronic
1193111039 X:77731162-77731184 CCAATACTGCAGAAATAAAAAGG + Intronic
1193647898 X:84090845-84090867 CCATTACTACAGAAACAAAGTGG + Intronic
1194326991 X:92531957-92531979 TCAATACTACAGGGACAAAGTGG + Intronic
1194477971 X:94382956-94382978 ACATTTCTAAAGAATCAAAGGGG + Intergenic
1195343348 X:103926000-103926022 CCATTTCTCCAGAGCCAAAGGGG - Intronic
1195363653 X:104107470-104107492 CCATTTCTCCAGAGCCAAAGGGG + Intronic
1195592636 X:106648595-106648617 CTATTACTAATGAAACAAACTGG - Intronic
1195710576 X:107770451-107770473 CTATTAATATAGTAACAAAGGGG - Intronic
1196278855 X:113799457-113799479 CCATTTCTACATTATCAAAGTGG + Intergenic
1197333388 X:125181329-125181351 CCTCTACTACAGAATTAAAGAGG + Intergenic
1197474225 X:126900888-126900910 ACAAAACCACAGAAACAAAGTGG + Intergenic
1198013198 X:132581165-132581187 CTATTATTACAGAAATAAAAGGG - Intergenic
1198056764 X:133003502-133003524 CCATTACAGCAAAAACCAAGTGG + Intergenic
1199140397 X:144304875-144304897 CAAATTTTACAGAAACAAAGAGG + Intergenic
1199446619 X:147930803-147930825 CCATTACTATAGAAACTAAGTGG + Intronic
1200125876 X:153814551-153814573 CCCATACTAGAGAAGCAAAGTGG - Intronic
1200635710 Y:5651167-5651189 TCAATACTACAGGGACAAAGTGG + Intronic
1200852630 Y:7901062-7901084 CCATTGGGACACAAACAAAGAGG - Intergenic
1201742249 Y:17336634-17336656 CAATTAATACATAAACAAAAAGG + Intergenic
1202270166 Y:23063892-23063914 CCATTCGTACACAAATAAAGAGG + Intergenic
1202295861 Y:23356790-23356812 CCATTCGTACACAAATAAAGAGG - Intergenic
1202390041 Y:24360375-24360397 CCAATACTATAGAGAAAAAGTGG - Intergenic
1202423160 Y:24697637-24697659 CCATTCGTACACAAATAAAGAGG + Intergenic
1202447629 Y:24972449-24972471 CCATTCGTACACAAATAAAGAGG - Intergenic
1202480743 Y:25309739-25309761 CCAATACTATAGAGAAAAAGTGG + Intergenic