ID: 1193648714

View in Genome Browser
Species Human (GRCh38)
Location X:84102698-84102720
Sequence AGGAGTACACACTTTGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193648714 Original CRISPR AGGAGTACACACTTTGTTGA AGG Intronic
900615441 1:3563578-3563600 AGAAGAACGCACTTTGCTGACGG + Intronic
904742413 1:32688600-32688622 TGGAGTACAAACTTTTTTTAAGG + Intronic
906181293 1:43821843-43821865 GGGAGTATCCACTTTGTTGTCGG - Intronic
907055327 1:51361324-51361346 AGGAGAATCCAATTTGTTGATGG + Exonic
908390023 1:63675709-63675731 AGGAGTAATCAGTTTGTAGAGGG + Intergenic
909196597 1:72634395-72634417 AGGAGTTCAGATTTTATTGAGGG - Intergenic
909233807 1:73125975-73125997 AGGATAAAACACTTTGTTCAAGG - Intergenic
909905169 1:81185543-81185565 TGAAGTACACAGTTTGATGAAGG + Intergenic
911804994 1:102194665-102194687 AGGAATTCACACTTTATGGAGGG + Intergenic
916157055 1:161862661-161862683 AGGAGGAAACAGTTTGTTCATGG + Intronic
917005514 1:170412056-170412078 ATGAGTTCACAGTTTGCTGAAGG - Intergenic
918649112 1:186938187-186938209 AGGAGGACACAATTTCTTGAGGG + Intronic
919083813 1:192896595-192896617 AGGAATTCACACATTGTTGGTGG - Intergenic
919136445 1:193513810-193513832 AGAAATACACACTTTGTTTTTGG - Intergenic
919402652 1:197138598-197138620 AGGAGTTCACACTTTAGTTAGGG + Intronic
919523796 1:198622088-198622110 AGCTGTACATTCTTTGTTGAGGG + Intergenic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
922127870 1:222746615-222746637 AGGATTATCCATTTTGTTGACGG + Exonic
922562840 1:226581638-226581660 AGGAGTACACACAGAGATGATGG + Intronic
1067313325 10:45136334-45136356 ACGTATACACACTTTGTTAAAGG - Intergenic
1071789819 10:88941928-88941950 AGGAGAGCACACCTGGTTGATGG + Intronic
1072626940 10:97118609-97118631 AGGAGAACACACATTATTAAGGG + Intronic
1074087075 10:110216355-110216377 AGGAGTACATACTTGCTTAATGG + Intronic
1079237751 11:18701867-18701889 AGGAAAACAGAATTTGTTGAGGG - Exonic
1085607417 11:77914471-77914493 AAAACTAAACACTTTGTTGAGGG + Intronic
1086343260 11:85868896-85868918 AGGAGCTCACAGTTTGTTGAGGG - Intronic
1090511369 11:127378914-127378936 AGGTGCAGACACTTTGTAGACGG - Intergenic
1092682608 12:11002483-11002505 AGGAGAATACTCTTTGTTGTAGG - Intronic
1093202540 12:16206947-16206969 ATGAGAACACACTATCTTGATGG - Intronic
1095508519 12:42924374-42924396 AGGAGCCCACACTCTGGTGAAGG + Intergenic
1099991757 12:89729805-89729827 AGGAGTACATACTTTGGTCAAGG + Intergenic
1108534718 13:51362903-51362925 AGGAAGACATACTCTGTTGATGG - Intronic
1110722121 13:78774460-78774482 AGGAGGAAACAGTTTGTTAATGG - Intergenic
1114368492 14:22057465-22057487 AGGAACACATACTCTGTTGATGG + Intergenic
1115962409 14:38850300-38850322 AGGAGATGACACTGTGTTGAGGG + Intergenic
1116990272 14:51268630-51268652 AGGAGTATATACTTTGATGAGGG + Intergenic
1117887330 14:60379112-60379134 AGGAGTGCAGATTTTATTGAGGG - Intergenic
1119218960 14:72891641-72891663 AGGAGCACACACGTTGTTATTGG - Intronic
1119326645 14:73763625-73763647 GGGAGTACAAATATTGTTGAGGG + Intronic
1120107787 14:80516208-80516230 AAGAGAACCCTCTTTGTTGAAGG - Intronic
1120411723 14:84165644-84165666 AGGTATACACACATTGTGGAGGG + Intergenic
1124819039 15:33024601-33024623 AGAATTCCACACATTGTTGATGG + Intronic
1126923972 15:53561432-53561454 AGGAATACCCTCTTTGCTGACGG - Intronic
1127516974 15:59705530-59705552 AGGGGTACACATTTTTTTAATGG - Intergenic
1128014893 15:64334912-64334934 AGAAGTACACTTTTTGGTGAAGG - Intronic
1128769370 15:70270349-70270371 AGGAGGACACACTGTGGTGTTGG + Intergenic
1130378394 15:83350844-83350866 AACAGTAACCACTTTGTTGAGGG + Intergenic
1130874962 15:88005802-88005824 AAGGGTAAAAACTTTGTTGAAGG - Intronic
1140119944 16:72074921-72074943 AGCAGAACACACTGTGGTGATGG - Intronic
1141466021 16:84206339-84206361 TGGAGGACACACTTTGGGGAAGG - Intergenic
1143241259 17:5444963-5444985 AGCAGTAGAGACATTGTTGAAGG - Intronic
1143350648 17:6285711-6285733 AGGAGTAAACCCTCTTTTGATGG + Intergenic
1146702125 17:34970341-34970363 AGGAGTACACACTTTATTGCTGG - Intronic
1147888906 17:43703429-43703451 AGCAGTACCCACTTTACTGATGG - Intergenic
1148155084 17:45418987-45419009 AGGAGTACCCACTTGGTGGGGGG - Intronic
1149257379 17:54841923-54841945 AAGAGTACTCACTTTGTGGGAGG - Intergenic
1153602886 18:6799143-6799165 AGAAGTAAACACATTGTTGAGGG - Intronic
1153626007 18:7023050-7023072 AGGAGGTCACACTCTCTTGAGGG - Intronic
1159860095 18:73637927-73637949 AGCAGTACCCCCTGTGTTGAAGG + Intergenic
1159862150 18:73661962-73661984 AGCATTACACATTTTCTTGATGG - Intergenic
1167732335 19:51267593-51267615 AGGAGCACACAGTGTTTTGAAGG + Intronic
926594296 2:14773434-14773456 ATGAGTACAGACTATTTTGAAGG - Intergenic
927607313 2:24498269-24498291 ATGAGTACGTACTTTGTTCAAGG + Intronic
930889827 2:56371636-56371658 AGGATTATACAGTTTGGTGATGG + Intronic
939144692 2:138397922-138397944 AGGAGTACAAAGTTTATTCAAGG + Intergenic
939849938 2:147292409-147292431 AGGAGTTTACACTATGTTGTGGG - Intergenic
941842379 2:170100200-170100222 AGAAATACAGACTTTGATGAAGG + Intergenic
943603382 2:189947858-189947880 AAAAGCACATACTTTGTTGATGG + Intronic
945584931 2:211649084-211649106 AGGAGTACACGCTTAGATCATGG + Intronic
1171380996 20:24734169-24734191 AGGAGCAAACACTGTGTTCAGGG + Intergenic
1172229879 20:33329592-33329614 AGGAATGTTCACTTTGTTGAAGG - Intergenic
1172789568 20:37493491-37493513 AGTAGCACAAACTTAGTTGAAGG - Intronic
1178921172 21:36739316-36739338 AGGATCACACAGTTTGTTGGAGG + Intronic
1182510680 22:30817774-30817796 AGGAGTTCACAGTCTGTTGTTGG + Intronic
950290506 3:11780302-11780324 AAGAGAACACAGTGTGTTGAGGG - Intergenic
952613162 3:35235767-35235789 AGGACTTTACACTTTGTTGCTGG - Intergenic
953334418 3:42081515-42081537 AGGAGCACACAATTTTTTGGGGG + Intronic
955563589 3:60220646-60220668 AGTAGCAGACACTGTGTTGATGG + Intronic
958088855 3:88849711-88849733 AGGAATGCATAGTTTGTTGAAGG - Intergenic
959995073 3:112671563-112671585 TGGAATACACACTGTGTTCAAGG + Intergenic
967484803 3:190017715-190017737 AGGAGCAAACACTTTGTTTGTGG + Intronic
967574177 3:191070889-191070911 AAGAGGACACACGTGGTTGAAGG - Intergenic
970424059 4:15930267-15930289 AGCAGGACACATATTGTTGAAGG + Intergenic
972871843 4:43310153-43310175 AGCAGAACACACTTTGTACATGG + Intergenic
974231298 4:59118044-59118066 AAGAGTACAGACATTTTTGAGGG + Intergenic
974539130 4:63210751-63210773 AGGAGAACACACTGTGGTGTGGG + Intergenic
975893708 4:79060492-79060514 AGGAGCTCACACTTTCTTTAAGG + Intergenic
980678496 4:136123821-136123843 GGGAGTACAAAGTATGTTGAAGG - Intergenic
983236968 4:165190481-165190503 AAGAGGACACACTACGTTGAAGG - Intronic
986552138 5:8969095-8969117 AGGGGTACTCACACTGTTGATGG - Intergenic
987780889 5:22433786-22433808 ATGGGTACACACATAGTTGAAGG - Intronic
990025689 5:51185005-51185027 TGGAGTAAACACTTTGATTATGG - Intergenic
991962193 5:72056306-72056328 TGGAGTGCACATCTTGTTGATGG - Intergenic
994587823 5:101733454-101733476 AGGTGTATACACTGTGTTGAAGG + Intergenic
995576938 5:113546844-113546866 AGGAGTCCTCAGTTTGTTGCTGG + Intronic
995803587 5:116026467-116026489 AGGAGCACATTCTTTGCTGAGGG + Exonic
998316367 5:141186589-141186611 AGTAGTTCACACATTGATGAAGG + Intergenic
1002871572 6:1171117-1171139 GGGAGTACACAGTTTTCTGAAGG + Intergenic
1004881793 6:20015960-20015982 AGGAATAGATACTTTCTTGATGG + Intergenic
1005204975 6:23392382-23392404 AGGATTCCACACGTTGTTGCTGG + Intergenic
1005551563 6:26922959-26922981 AGGAGCAAACACTTTGGGGATGG + Intergenic
1011044719 6:83068163-83068185 CGGAGTACCCTCTTTGTTGAAGG + Intronic
1011141793 6:84166113-84166135 AGGCATACTCACTTTCTTGAAGG - Intronic
1012744883 6:103073493-103073515 AGTATTCCACCCTTTGTTGATGG - Intergenic
1014989853 6:128061257-128061279 AGAAACACACACTTTGTTCAAGG + Intronic
1015066744 6:129039284-129039306 GGGAGAACATTCTTTGTTGAAGG + Intronic
1015542148 6:134325785-134325807 AGGAGTAGGCATTTGGTTGATGG + Intergenic
1023167259 7:37355117-37355139 AGGAGCACAGACTTTTATGAGGG + Intronic
1023341886 7:39229785-39229807 AGGATTACACACATTGTTTAGGG - Intronic
1024583347 7:50819240-50819262 AGCAGAAGCCACTTTGTTGAGGG + Intergenic
1025845588 7:65193757-65193779 AAAACTAAACACTTTGTTGAGGG - Intergenic
1025895807 7:65699470-65699492 AAAACTAAACACTTTGTTGAGGG - Intergenic
1028283091 7:88957999-88958021 AGAAGAACACATTTTGTTAATGG + Intronic
1029230308 7:99061993-99062015 AGGAGAAAACACTTTTTAGATGG - Intronic
1031331908 7:120475756-120475778 AGCATTACACACTTTGTATATGG - Intronic
1032300705 7:130683744-130683766 AGGCTTCCAAACTTTGTTGAGGG - Intronic
1035287360 7:157814846-157814868 AGGTGTCCACACTTTGCAGAGGG + Intronic
1038336041 8:26646347-26646369 AGCAGTACAAACTTTCTGGAAGG - Intronic
1041046246 8:53889159-53889181 AGCAATACACACTTTGCTGGTGG - Intronic
1042104722 8:65314195-65314217 AGGAGCACACAGTTTAGTGAGGG - Intergenic
1042889637 8:73593648-73593670 AGGACTACCCACATTGTGGAGGG - Intronic
1045693764 8:104785509-104785531 AGGTGTAGACATATTGTTGAGGG + Intronic
1046078476 8:109340567-109340589 AGGAATACAGAGTTTGTTAAAGG + Intronic
1057440417 9:95078991-95079013 AGGAAAGCACATTTTGTTGAAGG + Intronic
1058321846 9:103641848-103641870 AGAAGTTTACATTTTGTTGAAGG + Intergenic
1058668765 9:107343102-107343124 AGGAGTTCACACTGTCATGATGG - Intergenic
1058792703 9:108467011-108467033 AGGAGTACATACTTACTTTAGGG - Intergenic
1059972620 9:119683229-119683251 AGGAGTTCACACTGTGTTTGGGG + Intergenic
1060873678 9:127064024-127064046 TGGAGTCCATAATTTGTTGAGGG + Intronic
1190460924 X:50674108-50674130 AGGAAGACACACTGTGTTCATGG + Intronic
1192017528 X:67347607-67347629 AAGAGTTCACATTTTGTTCATGG - Intergenic
1193648714 X:84102698-84102720 AGGAGTACACACTTTGTTGAAGG + Intronic
1193801004 X:85936088-85936110 TGGAGTACCCATTTTGTAGAAGG + Intronic
1194205027 X:91002474-91002496 AGGAGTACCCTCTCTGCTGATGG - Intergenic
1195963548 X:110409672-110409694 AGGAGTACACGTATTATTGATGG - Intronic
1196178203 X:112663287-112663309 AGGAATACACACTCTAGTGAGGG - Intronic
1196901123 X:120384437-120384459 AGGAGTGGTGACTTTGTTGAAGG + Intergenic
1197066678 X:122241456-122241478 AAGAGTACAAACTATATTGAGGG - Intergenic
1200550852 Y:4577617-4577639 AGGAGTACCCTCTCTGCTGATGG - Intergenic