ID: 1193649056

View in Genome Browser
Species Human (GRCh38)
Location X:84108648-84108670
Sequence CTGGAGGCCTAGGGGATTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193649056_1193649063 -1 Left 1193649056 X:84108648-84108670 CCTTGAATCCCCTAGGCCTCCAG 0: 1
1: 0
2: 0
3: 22
4: 175
Right 1193649063 X:84108670-84108692 GTTTAATACACGGAGCTGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 81
1193649056_1193649064 13 Left 1193649056 X:84108648-84108670 CCTTGAATCCCCTAGGCCTCCAG 0: 1
1: 0
2: 0
3: 22
4: 175
Right 1193649064 X:84108684-84108706 GCTGCCTGGAATCTGTGCAGAGG 0: 1
1: 1
2: 5
3: 37
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193649056 Original CRISPR CTGGAGGCCTAGGGGATTCA AGG (reversed) Intronic
901096946 1:6689304-6689326 CTGAAGTCCTAGAGGATTCACGG + Intronic
901206738 1:7501903-7501925 CTGGAGGCCTCAGGGGCTCAGGG - Intronic
902096597 1:13950798-13950820 CTAGAGGTCAAGGGGGTTCAAGG + Intergenic
903377879 1:22877788-22877810 TTTGAGGACTAGTGGATTCAGGG - Intronic
908522307 1:64956204-64956226 CTGCTGGCCTAGGGTTTTCAGGG + Intronic
909649721 1:77960414-77960436 CTGGAGGCCCAGGAGGTCCATGG + Exonic
912702676 1:111889831-111889853 CAGGAGGCCTGGGGAAGTCAGGG + Intronic
919741223 1:200982732-200982754 ATGGAGGCCTAGGGGATGCTGGG - Intronic
919780349 1:201217041-201217063 CTGGAGGCTGAGGGGTCTCAGGG + Intronic
919806302 1:201382826-201382848 CTGGATGCATAGGGGAGTGAGGG - Intronic
919886655 1:201939994-201940016 CTGGAGGCTTCAGGGATTCTGGG - Intronic
923339644 1:232996445-232996467 CTGGAGGCCTGGGAGCTGCATGG + Intronic
1063108954 10:3018377-3018399 CTGCAGGCCCTGGGGGTTCAGGG - Intergenic
1063188504 10:3671225-3671247 CTGGGGGTCTGGGGGACTCAGGG + Intergenic
1064912182 10:20414887-20414909 CTGGTGGGGTAGGGGATGCACGG + Intergenic
1065684458 10:28270019-28270041 CCAGAGGCCTAGGGGATTCTGGG - Intronic
1065808013 10:29412769-29412791 ATGAAGGCCTAGAGCATTCAAGG - Intergenic
1066269330 10:33807098-33807120 CTGGGGGCCTGGGGAATACAAGG - Intergenic
1067316025 10:45163680-45163702 CTTGAGTGCTAGGGGATTGAAGG + Intergenic
1068891003 10:62148338-62148360 ATTGAGGCCTAGAGGATTCAGGG + Intergenic
1071301731 10:84261300-84261322 CGGGAAGCCTTGGGGATGCAAGG - Intergenic
1072564069 10:96602860-96602882 TCGGAGGCCTAGTGGACTCAGGG + Intronic
1073042174 10:100615184-100615206 ATGGAGGCCCAGGGGCTCCAGGG - Intergenic
1082128428 11:48457752-48457774 CTGGAGGCCTATGGGGTTGAGGG + Intergenic
1082154961 11:48798179-48798201 CTGGAGGCCTGTGGTATTAAAGG - Intergenic
1084484375 11:69439289-69439311 CTGGAGGCCTTGGGGGTGGAGGG - Intergenic
1088598302 11:111455824-111455846 CTGAAGGCCTGGGGCATTCTGGG + Exonic
1090615436 11:128510220-128510242 CTGGAGTCTTTGGTGATTCAAGG - Intronic
1090653010 11:128823694-128823716 CTGGAGGGCTAGGGCAGTCTGGG + Intergenic
1091530654 12:1352015-1352037 CTGGAGGCCTAATGGATCCTTGG - Intronic
1092791073 12:12071513-12071535 CTGGAGACCACGAGGATTCAGGG + Intronic
1093151330 12:15625255-15625277 CTTGAGGCCTAGTGCATACATGG - Intronic
1094870431 12:34596494-34596516 CATGAGGCCTAGGGGACTCTGGG + Intergenic
1096237509 12:49939769-49939791 CTGGAGTCCTAGGGGACCCAGGG + Intergenic
1098614089 12:72501012-72501034 CTGGAGGCATACTGTATTCATGG - Intronic
1099758796 12:86892500-86892522 CTGGAGGTCTGGGGGAGTTATGG - Intergenic
1102796823 12:115696124-115696146 CTGGAGCCCTAGGGAAACCAGGG + Intergenic
1103457800 12:121080015-121080037 CTGCAGGCCTGGGGGGTTCCGGG - Intergenic
1105245603 13:18647194-18647216 CTGCAGGCCCAGAGGATTCAGGG - Intergenic
1106761424 13:32872420-32872442 CTGCAGGCCCAGAAGATTCAGGG - Intergenic
1114083612 14:19221018-19221040 CTCTAGCCCTAGGGGATTTAGGG + Intergenic
1119090211 14:71773924-71773946 CTGTGGGCCAAGGGGACTCAGGG - Intergenic
1120681741 14:87488290-87488312 CTGGAGGCCGAGAGGAGTGAGGG - Intergenic
1122329990 14:100905371-100905393 CTGGAGGGCTCGGGGAGGCAGGG + Intergenic
1125317072 15:38442504-38442526 CTAGAGGCCTGGGGTAGTCAAGG + Intergenic
1128677697 15:69623909-69623931 AGGGAGGCCTAGGGGACTCTTGG + Intergenic
1128742399 15:70093017-70093039 CTGGGGGCCCAGGTGTTTCAAGG - Intronic
1137560646 16:49499949-49499971 CTGGAGGGACAGGGGACTCAGGG + Intronic
1137728145 16:50670649-50670671 GTGGGGGCCTAAGGAATTCAAGG + Intronic
1139319361 16:66101030-66101052 ATGGAGGCTTCGGGGATTGAAGG + Intergenic
1140719613 16:77759394-77759416 ATGGAGGCCTAGAGGATTAATGG - Intergenic
1140769469 16:78190227-78190249 CTGAAGGCCTAGGAGGTGCAGGG + Intronic
1142161386 16:88559377-88559399 CAGGGGGCCCAGGGGAGTCAAGG - Intergenic
1142933633 17:3309395-3309417 TTGGAGGCATGGGGAATTCAGGG + Intergenic
1143689366 17:8548067-8548089 CAGGAGGCCTTGGGAATTGAGGG - Intronic
1143733916 17:8897124-8897146 CTGGAGGAATTGGGGACTCATGG + Intronic
1144770811 17:17758400-17758422 CTGAAGGCCTGGGAGCTTCAGGG - Intronic
1146968253 17:37051264-37051286 TTGGAGGCCTGGGGGTTCCAGGG + Intronic
1146970055 17:37065274-37065296 GGGGAGGCCTGGGGGCTTCAGGG + Intergenic
1147321953 17:39651951-39651973 CTGTAGGCCTGGGGGCTACATGG + Intronic
1148243196 17:46013250-46013272 CTGGAGGCCCTGGGGACTCCAGG + Intronic
1148581574 17:48747505-48747527 CTGGAGGCCCAGGAGAAACACGG - Intergenic
1148636989 17:49156551-49156573 CTGGAGGCCTGGAGGACACAGGG - Exonic
1148798269 17:50207935-50207957 CTGGATGCCCAAGGAATTCAGGG + Intergenic
1149435689 17:56631483-56631505 CGGGAGGCTGAGGCGATTCAAGG - Intergenic
1152218634 17:79048847-79048869 CTGCAGGCCTGGGGGACCCAGGG - Exonic
1152309579 17:79541660-79541682 CTTGAGGCCTAGCGGTTTGATGG - Intergenic
1153225585 18:2897396-2897418 CTGGAGGCCTGGGGGTTTATAGG - Intronic
1154037325 18:10815858-10815880 GTGGAGGCCTAGGTGATGCTTGG + Intronic
1154443343 18:14412736-14412758 CTGCAGGCCCAGAGGATTCAGGG + Intergenic
1155268076 18:24113323-24113345 CAGGAGGCCTCGGGGAAACAAGG - Intronic
1156604538 18:38650680-38650702 ATCGAGGCCTTGGGGATACAAGG + Intergenic
1157510832 18:48272377-48272399 CTGGAGAACCAGGGGATCCAAGG - Intronic
1157723458 18:49944426-49944448 CTGGGTGCCTAGAGGAGTCAAGG + Intronic
1160143807 18:76348233-76348255 CTGGAGTTCTTGGGGGTTCAGGG - Intergenic
1160886386 19:1350929-1350951 CTGGAGACCCAGGGGCTCCACGG - Intergenic
1160920987 19:1520450-1520472 CTGGAGGCCCAGGAGGCTCATGG - Intergenic
1161703201 19:5805770-5805792 CTAGAGGCTAAGGGGATTCTGGG - Intergenic
1163234471 19:16022793-16022815 CTGGAGGGCTGGGGGATGCAGGG - Intergenic
1165106052 19:33470213-33470235 CTGGAGGCCTAGAGGCTGGAGGG - Intronic
1165473126 19:36014768-36014790 CTGAAGGCCCAGGGGGTCCAGGG - Exonic
1165815366 19:38638715-38638737 CTGGAGGGCTAGGGGGTTGGGGG + Intergenic
1167385967 19:49163845-49163867 CAGGGGAACTAGGGGATTCAAGG + Intronic
1167429437 19:49446156-49446178 CTGGAGGCCAGGAGGCTTCAGGG + Intergenic
1167667371 19:50830599-50830621 CTGGAGGCGTGGGGGTCTCAGGG + Intronic
1168175617 19:54625486-54625508 CTGTAGGCCAAGGGGGGTCAGGG + Intronic
925874699 2:8301929-8301951 CTGCAGGCCCAGGGGACTCAGGG + Intergenic
927448885 2:23189420-23189442 CTCGAGGCCTAGGGGAGACAAGG + Intergenic
929123412 2:38501836-38501858 CTGGAGGCTGAGGGTGTTCATGG - Intergenic
932197970 2:69800724-69800746 GCGGAGGTCTAGGGGAGTCATGG + Intronic
933289469 2:80421714-80421736 CTTGATGCCTAGGAGATACAGGG + Intronic
936439787 2:112541886-112541908 CTGGAGGCCTGGGGGAGGCCTGG - Intergenic
937986351 2:127639886-127639908 CAGGGGGTCTAGGGGATCCAGGG - Intronic
939100788 2:137892312-137892334 CTGCAGGCCCAGAGGATGCAGGG - Intergenic
941045053 2:160665351-160665373 AGGGAGGCCTAAGGGAATCAGGG + Intergenic
945683894 2:212946045-212946067 TTGGAGGGCTGGGGGAATCAAGG - Intergenic
947795251 2:232890324-232890346 CTGGAGGCATGGGAGACTCAGGG - Intronic
948238496 2:236408773-236408795 CTGGAGGCCTTGAGGTTTGAGGG + Intronic
1172083057 20:32358030-32358052 CTGGGGGCCTGCGGGATTCTGGG - Intergenic
1173282192 20:41638844-41638866 CTGGAGGCAGAGGGGACTCTAGG - Intergenic
1173973300 20:47168802-47168824 CTGGGGACCTAGGGGAGTCCTGG + Intronic
1175526804 20:59639930-59639952 CTGTCGGCCTAGGGGCATCATGG - Intronic
1175809299 20:61849182-61849204 ATGGAGGCCTTGGGGATGCCTGG + Intronic
1175951498 20:62585991-62586013 CTGGAAGCACAGGGGATTCAAGG - Intergenic
1176064357 20:63187084-63187106 GTGGAGGCCCAGGGGACACAGGG - Intergenic
1176452749 21:6878472-6878494 CTGCAGGCCCAGAGGATTCAGGG - Intergenic
1176799199 21:13406751-13406773 CTTGAGTGCTAGGGGATTGAAGG - Intergenic
1176830922 21:13743521-13743543 CTGCAGGCCCAGAGGATTCAGGG - Intergenic
1177393813 21:20508213-20508235 CTGGAGGCCTGGGAGTGTCAGGG + Intergenic
1179809084 21:43858959-43858981 CTGGAGGCCTGTGTGACTCAGGG - Intergenic
1180159082 21:45991060-45991082 CTGGAGGACCAGGGCCTTCACGG + Intronic
1180294363 22:10872249-10872271 CTCTAGCCCTAGGGGATTTAGGG - Intergenic
1180497169 22:15901663-15901685 CTCTAGCCCTAGGGGATTTAGGG - Intergenic
1180858756 22:19064692-19064714 CTGGAAGCCCAGGAGATCCATGG - Intronic
1181038934 22:20182885-20182907 CTGGAGGACAAGGGGAGGCAGGG + Intergenic
1181069587 22:20324453-20324475 CTGAATGCCTGAGGGATTCAGGG - Intergenic
1181492187 22:23267550-23267572 CTGGAAGCCCAAGGCATTCACGG - Intronic
1181631516 22:24154080-24154102 CTGGAGGCCTCTGGGATGCAGGG + Intronic
1181772317 22:25134725-25134747 TGGGAGGCCTAGTGGTTTCAAGG + Intronic
1184765330 22:46569268-46569290 CTGCAGGCCCAGGGGTTTGAGGG + Intergenic
1185254701 22:49825956-49825978 CTGGAGGCCCTGGAGATGCAGGG - Intronic
950469885 3:13177937-13177959 CCCCAGGCCTAGGGGATGCAGGG - Intergenic
950588566 3:13917042-13917064 TTGGAGGCCTAGAGGGTTGAGGG + Intergenic
951221001 3:20068915-20068937 CTGGAGGCTTAGGGAGTTCCTGG + Intronic
954699932 3:52445801-52445823 CTGGAGGCCTGAGGGAGGCAGGG - Intergenic
956576365 3:70757032-70757054 CTGGATGCACAGGGGAGTCAGGG - Intergenic
956892124 3:73623637-73623659 CTGGAATCCTAGAGGATGCACGG + Intronic
958027673 3:88067845-88067867 CTGGAGGCATTGTGGATTGAAGG + Intronic
958473217 3:94548679-94548701 TTAGAGGCCCAGGGGAGTCAGGG - Intergenic
960397543 3:117155672-117155694 GTGGAGACCTAGGGGATCAAAGG + Intergenic
961290219 3:125840763-125840785 CTGGAGGGCTAGGGGCCACATGG - Intergenic
961724708 3:128919832-128919854 CTGGAGGCCTAGAGGTACCAGGG - Intronic
964041629 3:152268621-152268643 CGGGAGGCCGAGGGGATCCACGG + Exonic
964876444 3:161372835-161372857 CTCGAGGCCCAGGGGAGTCCGGG + Exonic
967955889 3:194876911-194876933 CTGGGGGCTTGGGGGATGCAGGG + Intergenic
969091330 4:4695984-4696006 CTTGAAGCCTAGTGGCTTCAGGG - Intergenic
970414177 4:15840078-15840100 CTAGAGGCCTGGGTGATACATGG + Exonic
972349778 4:38225928-38225950 TGGGAGGCCAAGGTGATTCAAGG - Intergenic
977022723 4:91776405-91776427 CTGGAGGCCACGTGGATTCCTGG + Intergenic
982046185 4:151448463-151448485 CTGGAGGCCAAGGGGGATAATGG - Intronic
989581206 5:43034726-43034748 CAGCAAACCTAGGGGATTCAGGG - Intergenic
990008219 5:50966730-50966752 CTTGAGGCCCAGGGATTTCAAGG - Intergenic
992572828 5:78077359-78077381 CAGTTGGCCTTGGGGATTCATGG - Intronic
995991055 5:118240181-118240203 TTGCAGGACCAGGGGATTCAAGG - Intergenic
996207423 5:120758683-120758705 CAGGAGGCCAAGGGGAAGCAAGG - Intergenic
997256891 5:132435917-132435939 CTGGAGGCTCATGGGATACAGGG + Intronic
997306485 5:132840877-132840899 CTGGAGGCCAAGGCCATTCTTGG - Intergenic
999393070 5:151208466-151208488 CTGGAGGACTGAGGGAGTCATGG + Intronic
1000288809 5:159850581-159850603 CTGGGTTCCTGGGGGATTCAAGG - Intergenic
1003254032 6:4458970-4458992 CTGGCGGCCATGGGGCTTCAAGG - Intergenic
1004840709 6:19580950-19580972 CTGGAGGCCTAGGAGAACCAAGG + Intergenic
1005661066 6:28000307-28000329 CTGCAGGCCTGAGGGGTTCAAGG - Intergenic
1005681357 6:28211951-28211973 CTGGAGCCCTGGGGGCGTCAAGG - Intergenic
1007619881 6:43205436-43205458 CTGGAGGCATAGGGGATGGGAGG + Intronic
1008444107 6:51568750-51568772 CTGGAAGATTAGGGGATGCAAGG - Intergenic
1008700342 6:54091745-54091767 CTGGAGGCCTAGGGTTTAGAAGG - Intronic
1011185750 6:84673683-84673705 CTTGAGGCCTTGGGAAGTCATGG + Intergenic
1013368228 6:109450267-109450289 CAGGAGGCACAGGGGTTTCATGG - Intronic
1015898089 6:138036243-138036265 CTGGAGGCCTAGGAGTATGACGG - Intergenic
1019476122 7:1245282-1245304 CTGGAGGCCCTGGCGTTTCAGGG - Intergenic
1019514727 7:1434665-1434687 CTGGAGGCCTAGGGGACAGGTGG + Exonic
1020087777 7:5320782-5320804 CTGTAGGACTAGGGGTTGCAAGG + Intronic
1020513587 7:9089883-9089905 CTGGAGCTCTGGGGGATCCAAGG - Intergenic
1022454602 7:30547287-30547309 CTAAAGTCCTAGGGGTTTCAAGG - Intronic
1022589796 7:31650857-31650879 CTGGAGGCCTAGGTGACATAGGG - Intronic
1028398855 7:90403350-90403372 CTGGCGGCCCAGTGGATTCTGGG + Intronic
1029456920 7:100676162-100676184 CCCGAGGCCTGGGGGATGCAGGG - Exonic
1031510104 7:122638648-122638670 CTAGAGGCCCAAGGGAGTCATGG + Intronic
1034453089 7:151148359-151148381 CTTCAGGACTAGGGGCTTCAAGG - Intergenic
1037918593 8:22788040-22788062 CTGGAGGCTTCAGGGATGCACGG + Intronic
1039407364 8:37325110-37325132 CTGCAGGCCAATGGGATTCCTGG - Intergenic
1039954255 8:42195146-42195168 CTGGAGGCACAGGGGCTTCCAGG + Intronic
1040955312 8:52974042-52974064 CTGGAGACCCAGGGGAGCCAGGG - Intergenic
1041791427 8:61700110-61700132 GTGGAGGCCCAGGGGATTGAGGG + Intronic
1042252193 8:66767628-66767650 CTCGAAGCCTAGAGGATTGAAGG + Intronic
1046226376 8:111285748-111285770 CTGGAGGCCTAGGGGTAAAAAGG - Intergenic
1047939642 8:129816587-129816609 CTGGAAACCCAGGGGAGTCAGGG + Intergenic
1047970092 8:130077127-130077149 CTGGAGGCCCAGGGGAGCTAGGG - Intronic
1048551011 8:135433622-135433644 CTGCAGGCCTAGGAGTGTCATGG + Intergenic
1048846881 8:138610642-138610664 CTGGGGGCCTTGGGATTTCAGGG + Intronic
1048862422 8:138733767-138733789 CTTGAGGCCTTGTGGATGCAGGG + Intronic
1050733750 9:8739197-8739219 CTGAGGGCCTAGGGAATTCCTGG - Intronic
1052448957 9:28601470-28601492 CTGGAGGACTAGAGGTATCAGGG + Intronic
1054990411 9:71319309-71319331 CTGGAGGCCTAGGAAAGCCAGGG + Intronic
1055938753 9:81628393-81628415 CCGGAGGCCTATGGGAACCATGG - Intronic
1056028540 9:82526279-82526301 TTGCAGGCCTAGGGGGTTCAGGG - Intergenic
1058011424 9:99981622-99981644 CTGCAGGCCTGGGGAAATCAGGG + Exonic
1059733698 9:117081201-117081223 CTGCAGGACAAGTGGATTCAGGG - Intronic
1203516432 Un_GL000213v1:6043-6065 CTGCAGGCCCAGAGGATTCAGGG + Intergenic
1185544618 X:933677-933699 CTGGAGGCATAGGGGCTGCATGG - Intergenic
1186157137 X:6737558-6737580 CTGGGTGCCTAGGGCATTCCAGG - Intergenic
1186975694 X:14901690-14901712 CTGGAGGCCTTAAGGAATCAGGG - Intronic
1188909546 X:35829656-35829678 CTGTAGGCCTTGGAGAGTCATGG - Intergenic
1193649056 X:84108648-84108670 CTGGAGGCCTAGGGGATTCAAGG - Intronic
1193726171 X:85041706-85041728 CTGGAGGCCTTGGGAATAGAGGG + Intronic
1194558688 X:95394140-95394162 CTGGAGCCCTAGGGTTTTGATGG + Intergenic
1195704459 X:107728943-107728965 CTGGTGGCCTTGGGATTTCAGGG + Intronic
1200884025 Y:8251771-8251793 CATGAGGCCTGGGGCATTCACGG - Intergenic