ID: 1193657526

View in Genome Browser
Species Human (GRCh38)
Location X:84216648-84216670
Sequence CCATTACAGCAGGTGGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193657522_1193657526 -2 Left 1193657522 X:84216627-84216649 CCTGGAACATGGACGCTGCTTCC No data
Right 1193657526 X:84216648-84216670 CCATTACAGCAGGTGGTGCATGG No data
1193657520_1193657526 3 Left 1193657520 X:84216622-84216644 CCCTGCCTGGAACATGGACGCTG No data
Right 1193657526 X:84216648-84216670 CCATTACAGCAGGTGGTGCATGG No data
1193657517_1193657526 18 Left 1193657517 X:84216607-84216629 CCTGCACAGGTGGCTCCCTGCCT No data
Right 1193657526 X:84216648-84216670 CCATTACAGCAGGTGGTGCATGG No data
1193657521_1193657526 2 Left 1193657521 X:84216623-84216645 CCTGCCTGGAACATGGACGCTGC No data
Right 1193657526 X:84216648-84216670 CCATTACAGCAGGTGGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193657526 Original CRISPR CCATTACAGCAGGTGGTGCA TGG Intergenic
No off target data available for this crispr