ID: 1193659172

View in Genome Browser
Species Human (GRCh38)
Location X:84236417-84236439
Sequence GTGGCAGGTGTGATGCATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193659164_1193659172 18 Left 1193659164 X:84236376-84236398 CCTTTCTATAAACACCAAGTCTT No data
Right 1193659172 X:84236417-84236439 GTGGCAGGTGTGATGCATGGGGG No data
1193659166_1193659172 4 Left 1193659166 X:84236390-84236412 CCAAGTCTTCAGGCACAACATAC No data
Right 1193659172 X:84236417-84236439 GTGGCAGGTGTGATGCATGGGGG No data
1193659163_1193659172 21 Left 1193659163 X:84236373-84236395 CCACCTTTCTATAAACACCAAGT No data
Right 1193659172 X:84236417-84236439 GTGGCAGGTGTGATGCATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193659172 Original CRISPR GTGGCAGGTGTGATGCATGG GGG Intergenic
No off target data available for this crispr