ID: 1193663128

View in Genome Browser
Species Human (GRCh38)
Location X:84281268-84281290
Sequence TACGGGCGTGGGCCACCGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193663123_1193663128 -7 Left 1193663123 X:84281252-84281274 CCCAAAGTGCTGGGATTACGGGC 0: 1655
1: 220799
2: 273755
3: 186508
4: 142945
Right 1193663128 X:84281268-84281290 TACGGGCGTGGGCCACCGCAGGG No data
1193663120_1193663128 -4 Left 1193663120 X:84281249-84281271 CCTCCCAAAGTGCTGGGATTACG 0: 2604
1: 296063
2: 268467
3: 154459
4: 133890
Right 1193663128 X:84281268-84281290 TACGGGCGTGGGCCACCGCAGGG No data
1193663116_1193663128 9 Left 1193663116 X:84281236-84281258 CCACCTGCGTCGGCCTCCCAAAG 0: 123
1: 28858
2: 120314
3: 164086
4: 163373
Right 1193663128 X:84281268-84281290 TACGGGCGTGGGCCACCGCAGGG No data
1193663117_1193663128 6 Left 1193663117 X:84281239-84281261 CCTGCGTCGGCCTCCCAAAGTGC 0: 376
1: 88635
2: 228391
3: 238562
4: 154648
Right 1193663128 X:84281268-84281290 TACGGGCGTGGGCCACCGCAGGG No data
1193663114_1193663128 20 Left 1193663114 X:84281225-84281247 CCTCAGGTGATCCACCTGCGTCG 0: 37
1: 6572
2: 28519
3: 60343
4: 86692
Right 1193663128 X:84281268-84281290 TACGGGCGTGGGCCACCGCAGGG No data
1193663113_1193663128 25 Left 1193663113 X:84281220-84281242 CCTGACCTCAGGTGATCCACCTG 0: 15509
1: 42872
2: 77507
3: 95405
4: 101587
Right 1193663128 X:84281268-84281290 TACGGGCGTGGGCCACCGCAGGG No data
1193663124_1193663128 -8 Left 1193663124 X:84281253-84281275 CCAAAGTGCTGGGATTACGGGCG 0: 845
1: 125027
2: 272616
3: 224826
4: 154182
Right 1193663128 X:84281268-84281290 TACGGGCGTGGGCCACCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193663128 Original CRISPR TACGGGCGTGGGCCACCGCA GGG Intergenic
No off target data available for this crispr