ID: 1193665764

View in Genome Browser
Species Human (GRCh38)
Location X:84314418-84314440
Sequence TGCCCCAGATCTCAGAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193665764_1193665769 23 Left 1193665764 X:84314418-84314440 CCTTTTCTCTGAGATCTGGGGCA No data
Right 1193665769 X:84314464-84314486 ACTGTTCTTCAAAATAGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193665764 Original CRISPR TGCCCCAGATCTCAGAGAAA AGG (reversed) Intergenic
No off target data available for this crispr