ID: 1193667319

View in Genome Browser
Species Human (GRCh38)
Location X:84337920-84337942
Sequence TTTTTTAAGGGGCTGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 555
Summary {0: 1, 1: 0, 2: 8, 3: 62, 4: 484}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193667319_1193667328 22 Left 1193667319 X:84337920-84337942 CCCTCCACCAGCCCCTTAAAAAA 0: 1
1: 0
2: 8
3: 62
4: 484
Right 1193667328 X:84337965-84337987 TCTCTCTTTATCTCTTCTTTTGG 0: 1
1: 3
2: 11
3: 151
4: 1420

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193667319 Original CRISPR TTTTTTAAGGGGCTGGTGGA GGG (reversed) Intronic
900337940 1:2174071-2174093 TTTTCAAAGGTGCAGGTGGAGGG + Intronic
901310661 1:8267209-8267231 TTTTTTAAGATGGGGGTGGATGG + Intergenic
901729349 1:11267600-11267622 GTTTTTAAGGGGATTGTAGAGGG + Intergenic
902757806 1:18560646-18560668 TTTTTTATGGGGGTGGTGGGGGG - Intergenic
902960117 1:19957371-19957393 TTCTTTAAGGAGGTAGTGGAGGG + Intergenic
903646609 1:24899942-24899964 TTTTGTCAGGGGATGGGGGATGG + Exonic
903971040 1:27118974-27118996 TTTTAGAAGAGGCTGGGGGATGG + Intronic
904314324 1:29650554-29650576 TTTTTTGGGGGGTGGGTGGATGG + Intergenic
904722040 1:32517473-32517495 TTTTTTGGGGGGGTGGTGGGGGG - Intronic
904973345 1:34435944-34435966 TTTATTAAGGATCTGGTTGAAGG + Intergenic
906850046 1:49238471-49238493 ATTCTTAAGTGGGTGGTGGAAGG + Intronic
906896173 1:49774476-49774498 CTTTATATGGGGCAGGTGGAGGG + Intronic
907318726 1:53589390-53589412 GTTTCTCAGGGGCTGGCGGAGGG + Intronic
908058352 1:60317657-60317679 TTTTTAAAAGGATTGGTGGAAGG - Intergenic
908912602 1:69089475-69089497 TTTTTTAGGGGGATGGGGAAGGG + Intergenic
909262440 1:73509483-73509505 TCTTTTAAGAGGCTGTTTGAAGG - Intergenic
909654639 1:78017670-78017692 TGTTTTCAGGGGCTGGAGGAAGG - Exonic
910873340 1:91854522-91854544 TTTTATAGGGGGCTGTAGGAAGG - Intronic
910875308 1:91872957-91872979 TTTTTTGACGGGGTGGTGGGAGG + Intronic
911180882 1:94859296-94859318 TTTTTTGAGTGGCTGGAGAAAGG - Intronic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915273353 1:154771307-154771329 TGTTTTAGGAGGCTGGTGGTTGG - Intronic
915437160 1:155916098-155916120 TTTATAAAGGGGCTGGGGGAAGG - Intronic
915463473 1:156082672-156082694 TTTTTTAAGGGGAGGGTGCGGGG + Intronic
915548509 1:156617785-156617807 TGTTTACAGGGGCAGGTGGAGGG + Intergenic
915638452 1:157202980-157203002 ATTTTTAAGGAGCTTGAGGAAGG + Intergenic
915713502 1:157923212-157923234 TTTTTAAAGTGGCTGGGGGAGGG + Intergenic
915816609 1:158973748-158973770 TTATTTAAGGAACTGCTGGATGG - Exonic
916965901 1:169942911-169942933 TTTTTTAAAGGGGTGGGGGGGGG - Intronic
917090614 1:171349932-171349954 GATTTTAAGGGGATTGTGGAGGG + Intergenic
918266092 1:182843285-182843307 TTTTTAAAGGTTCAGGTGGAAGG + Exonic
918475503 1:184919905-184919927 TTTTTTCAGGGGCTGGGGGAGGG + Intronic
919570388 1:199241985-199242007 TTTTTTAAGGTGATGGGGTAGGG - Intergenic
919727525 1:200893864-200893886 ACTTTTTAGGGGCTGGGGGAGGG + Intronic
919795477 1:201319082-201319104 TTTTTTCATGGGGTGGAGGAGGG - Intronic
920784450 1:209027429-209027451 TTTTTGAAGGGGAAGGTGGGGGG + Intergenic
921266276 1:213423392-213423414 GTTTCTTAGGGGCTGGTTGAAGG - Intergenic
921330457 1:214030534-214030556 TTTTTAAAGGGGATTGAGGAGGG + Intronic
921676923 1:217986787-217986809 TGGTTTAAGGGGTTGGTGGTGGG - Intergenic
921720124 1:218462262-218462284 TTTTTTCAGAGGCTGGTTGTTGG + Intergenic
921825071 1:219663346-219663368 CTTTTTAAAGGGGTGGTGGCTGG - Intergenic
922421373 1:225463018-225463040 ATTTTTAAGGGGATCATGGAGGG - Intergenic
924034552 1:239923172-239923194 GTTTTTAAGGGGATTATGGAAGG + Intergenic
1062937485 10:1399210-1399232 TTTTCTAAGAGGCTGAAGGAGGG + Intronic
1063134158 10:3201853-3201875 CTTTCTGAGGGGCTGGGGGAGGG + Intergenic
1063319225 10:5037152-5037174 TTTGTTAAGGGGCTCAAGGAGGG - Intronic
1063616265 10:7603033-7603055 TTTCTTCAGTGGCTGATGGAAGG - Intronic
1063690572 10:8283297-8283319 TTTTTTCTGATGCTGGTGGAAGG - Intergenic
1063712698 10:8495077-8495099 TTTTTTTGGGGGGTGGTGGCAGG + Intergenic
1065158389 10:22894231-22894253 TTTTTCCATGGGCTGGTGGTGGG + Intergenic
1065952248 10:30662847-30662869 TTTTTGCAGGGCCAGGTGGAGGG + Intergenic
1066308041 10:34166462-34166484 TTTTTTAATTAGCTGGGGGATGG + Intronic
1067049560 10:43005222-43005244 TTTGATAAGTGTCTGGTGGATGG - Intergenic
1067170910 10:43904933-43904955 TTCTTCAAGGGGCTGGTAGAGGG + Intergenic
1067590806 10:47508066-47508088 TTTTTTGGGGGGGTGGTGGGTGG + Intronic
1067637925 10:48016166-48016188 TTTTTTGGGGGGGTGGTGGGTGG + Intergenic
1068953359 10:62800573-62800595 ATTTTTAAGAGGTTGGTGGTGGG - Intergenic
1068982488 10:63076240-63076262 TTTTTTGAGGGGGAGGGGGAAGG + Intergenic
1069827301 10:71262127-71262149 CTTTTTATGGGGCTGGTTAAAGG - Intronic
1070048384 10:72862368-72862390 TGTCCTATGGGGCTGGTGGAAGG - Intronic
1070077006 10:73146348-73146370 TTTTTTAAGGGACTGATAGAAGG - Exonic
1070299862 10:75195682-75195704 TTTTTTGGGGGGTTGGAGGAGGG - Intergenic
1070380265 10:75875054-75875076 ATTATCCAGGGGCTGGTGGATGG - Intronic
1070427374 10:76302525-76302547 TTTTTTTGGGGGGTGGTGGTGGG + Intronic
1071361598 10:84851737-84851759 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1071827790 10:89342429-89342451 TTGTTTAAGGAGCAGGAGGATGG - Intronic
1072094614 10:92165412-92165434 TTTTTTTTTTGGCTGGTGGAAGG + Intronic
1073205071 10:101764739-101764761 TTTTTTGAGGGGCGGGGGGATGG - Intergenic
1073390775 10:103174568-103174590 TTTTTTGAGGGAGTGCTGGATGG - Intronic
1073464798 10:103688316-103688338 TTTTTGAATGGGTGGGTGGATGG - Intronic
1073617152 10:105007647-105007669 TTTTTTGGGGGGTTGGGGGAGGG - Intronic
1073649863 10:105346890-105346912 TTATTTTAGGGAGTGGTGGAAGG - Intergenic
1074706952 10:116141579-116141601 TTTTTTGAGGGGGTGGTGGGCGG + Intronic
1074961929 10:118454767-118454789 TTTTCTAAGGTTCTGGTGTAGGG - Intergenic
1075154929 10:119967362-119967384 GTTTTTAAGGAGATTGTGGAGGG + Intergenic
1075380988 10:122018548-122018570 TGTTGTCAGGGGCTGGGGGAAGG - Intronic
1075995671 10:126874245-126874267 TGGTTTAAGAGGCTGGTGGTTGG - Intergenic
1076303718 10:129448067-129448089 TTTTTTGTGGGGCAGGGGGATGG - Intergenic
1076496427 10:130900556-130900578 TTTTTTGTGGGGGTGGGGGACGG - Intergenic
1077365655 11:2160511-2160533 TTGTTTGAGGGGCGAGTGGAGGG + Intronic
1079036059 11:17021140-17021162 GCTTTTAAGGGGATTGTGGAGGG - Intergenic
1079353667 11:19713562-19713584 TTTTTTTAGCCGCTGGTGGTGGG + Intronic
1079371612 11:19858217-19858239 GTTTACCAGGGGCTGGTGGATGG - Intronic
1080104721 11:28499978-28500000 TTGTTTAAAGGGCAGGTGGTTGG + Intergenic
1080864617 11:36182367-36182389 TTTTTGCGGGGGCAGGTGGAGGG - Intronic
1081110910 11:39132059-39132081 GTTTTAAAGGGGATGGTGGAAGG - Intergenic
1082170722 11:49001818-49001840 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1082837898 11:57664971-57664993 TTTTTTCTGGTGCTGGGGGATGG - Intergenic
1083000303 11:59284888-59284910 TTTTTTAAGTGGGTGCTGAAGGG - Intergenic
1083459452 11:62801047-62801069 TTTTTGAAGGGGTGGGTAGAGGG - Intronic
1083800710 11:65044847-65044869 TTATTTGAGGGGCTGTTGTAGGG + Exonic
1084207274 11:67602973-67602995 TTTTTTAAGGAGATTGTGGAGGG + Exonic
1084728189 11:71055763-71055785 GTTTTCTAGGGGCTGGGGGAGGG + Intronic
1085307795 11:75498079-75498101 TGTTGTGGGGGGCTGGTGGAGGG + Intronic
1085342084 11:75738759-75738781 TTTTTTTGGGGGGTGGGGGATGG - Intergenic
1085639970 11:78187529-78187551 TTCTGGAAGGGGCTGGGGGATGG - Intronic
1085782311 11:79420677-79420699 TTTTTTTGGGGGGTGGGGGATGG + Intronic
1086453500 11:86939772-86939794 TTTTTAAAGGGGTGGGTGGGGGG + Intronic
1086695083 11:89834542-89834564 ATTTTTAAGGGGATTGTGGAAGG + Intergenic
1086711067 11:90009942-90009964 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1087660726 11:100985104-100985126 TATTTTATGGGACTGGTTGAGGG - Intronic
1087837047 11:102885847-102885869 TTATTTAAGTGACAGGTGGATGG + Intergenic
1088588012 11:111377072-111377094 TTTTTAAAGGGGATGCTGGAGGG - Intronic
1089267272 11:117273719-117273741 AGTTTTAAGGGGATTGTGGAAGG + Intronic
1090127345 11:124101026-124101048 TTTTTTGAGGGGGGTGTGGAAGG + Intergenic
1090508092 11:127341156-127341178 TTTTTCAAGGGGTAGGTGGTAGG + Intergenic
1090767423 11:129888551-129888573 TCTTTGAGGGGGGTGGTGGATGG - Intronic
1091398647 12:169759-169781 CTTTATTTGGGGCTGGTGGAGGG - Intronic
1091621433 12:2092213-2092235 TTTATGTAGGGGCTGGGGGAAGG - Intronic
1091849585 12:3684428-3684450 TTGGTTAAGGGGGTAGTGGAGGG + Intronic
1093446677 12:19267657-19267679 TTTTTTGGGGGGTTGGGGGAGGG - Intronic
1093929203 12:24938024-24938046 TATTTTAAGGTGCATGTGGATGG - Intronic
1094734507 12:33219377-33219399 TTTTTTGATGTGCTGCTGGATGG + Intergenic
1096713071 12:53471988-53472010 GTTTTCAAGGGGTTGGTGGGGGG + Intronic
1097085781 12:56467248-56467270 TTTTTTGAGGGGTAGGAGGATGG + Intronic
1097886970 12:64738810-64738832 TTTTTTGGGGGGCTGGTGGGGGG - Intronic
1098311271 12:69151511-69151533 TTATTGAATGGGCGGGTGGATGG - Intergenic
1098427889 12:70386606-70386628 TTTTTTAAGGAGATGGGGAAAGG + Intronic
1099620379 12:84996201-84996223 ATTTTTAAGGGGATTGTGAAGGG - Intergenic
1099738209 12:86597787-86597809 CTTTTTAAAGGGATTGTGGATGG - Intronic
1101350502 12:103926064-103926086 TTTTTTAAGGGGCTGGGCAGTGG + Intergenic
1101756910 12:107628136-107628158 TTTTTTTGGGGGGTGGGGGAGGG + Intronic
1102757233 12:115352085-115352107 GGTTTTCAGGGGCTAGTGGAGGG - Intergenic
1103015233 12:117489191-117489213 ATTATTAGGGGGCTGGGGGAAGG + Intronic
1103025785 12:117572683-117572705 TTTTTTAATGGGCTGGAGTGTGG - Intronic
1104463999 12:128975858-128975880 TGTTTTAAGAGGTGGGTGGAAGG + Intronic
1105410795 13:20169605-20169627 TATTTTAAGGAGCTGGAGAAGGG - Intergenic
1106146248 13:27052459-27052481 TTTCTTACGGGGCTGGAGGCTGG - Intergenic
1107018354 13:35726953-35726975 TTTTTTAAGTGGATGATGGTGGG - Intergenic
1107761638 13:43685625-43685647 TTTTTTAAGTTGCCGGTGGTAGG + Intronic
1108672031 13:52700968-52700990 TTATTTGAGGTGCTGGTGGAAGG + Intergenic
1109212014 13:59545839-59545861 GCTTTTTAGGGGCTGGTGTAGGG + Intergenic
1109957768 13:69590857-69590879 TTTTTGAGGGGGGTGGTGGGAGG + Intergenic
1109976833 13:69848031-69848053 CTATTTAAGGTGCTGGTGAAAGG + Intronic
1110307120 13:74001228-74001250 GGTTTTGAGAGGCTGGTGGAAGG + Intronic
1111577726 13:90180068-90180090 TTTTTTAATGGGTTGGAGAAGGG - Intergenic
1112710077 13:102117165-102117187 TTTTTTCTGGTGCTGGTGGTTGG + Intronic
1112880772 13:104104066-104104088 TTTTTTGAGGGGGTGGGGGATGG + Intergenic
1113281169 13:108789499-108789521 ATTTTGAAGAGGCTGGTGCAGGG - Intronic
1114096713 14:19343664-19343686 TTTTTTGGGGGGGTGGGGGATGG - Intergenic
1114958049 14:27848338-27848360 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1115995636 14:39193012-39193034 TTTTTTAAGTTGTGGGTGGAGGG + Intergenic
1116091572 14:40313698-40313720 TTTTTTGTGGGGGTGGTGGCTGG - Intergenic
1117031400 14:51674702-51674724 TTTTTAAAGGGTGTGGGGGAAGG - Intronic
1117516313 14:56505298-56505320 GTCTTTCAGGGGCTGGTGGAGGG + Intronic
1117671470 14:58111059-58111081 TTTTTTAATGGACTGGTTTATGG + Intronic
1117745880 14:58869140-58869162 ATTTTTAAGGGGATGGTCGCTGG - Intergenic
1118405842 14:65422801-65422823 TTTTTTAATTAGCTGGGGGAAGG - Intronic
1118415887 14:65536417-65536439 TTCTTTAAGGGGCTCTTGTAAGG + Intronic
1118702967 14:68452083-68452105 TTTCTTATGGGTCTTGTGGATGG + Intronic
1120950491 14:90036800-90036822 TTTTTTAAGGGGCGGGGGAGGGG - Intronic
1121023237 14:90594910-90594932 TTTGGTGAGGGGTTGGTGGATGG + Intronic
1121056290 14:90856829-90856851 GTTTTTCAGGGGCTGGTGGGAGG - Exonic
1121315868 14:92960723-92960745 TGGTTAAAGGGGCTGGTGGAAGG + Intronic
1121935727 14:98016880-98016902 TTTATTGAGGGGGTGGTGGTGGG - Intergenic
1123949989 15:25262072-25262094 TTTTTTTTGGGGGGGGTGGAGGG - Intergenic
1124198014 15:27650221-27650243 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1124583709 15:30986011-30986033 ATTTTTCAGAGGATGGTGGAAGG + Intronic
1125080688 15:35669329-35669351 TTTTTTGGTGGGCTGGTGGGGGG + Intergenic
1125176125 15:36823801-36823823 TTTTTTTAGGGGATGGGGGTTGG + Intergenic
1128120232 15:65140648-65140670 ATTTTTAAGGGGGTTGTGGAGGG - Intergenic
1128430220 15:67586049-67586071 TTTTTTAAATGGGAGGTGGAGGG + Intronic
1128757785 15:70195230-70195252 TTTCTAAAGGGCTTGGTGGAAGG - Intergenic
1129508982 15:76106148-76106170 TCTTTGCAGGGGCTGGGGGATGG - Intronic
1129568358 15:76649435-76649457 TTTTTTTTGGGGGTGGTGGTGGG - Intronic
1129620719 15:77142812-77142834 TGTTGTAAGGGGCTGGGGGAAGG + Intronic
1130083093 15:80751763-80751785 TTTTTTAAAAGGCTGGTGATTGG + Intronic
1131884258 15:96893864-96893886 TTTTTTGTGGGGGTGGTGGGGGG - Intergenic
1131985282 15:98037376-98037398 TTTTTAAAGTGGATGATGGAAGG - Intergenic
1132968972 16:2675768-2675790 TTTTTTCGGGGGGTGGGGGACGG - Intergenic
1133783786 16:8959804-8959826 TTTGTTACGGGGGTGGTGGTGGG - Intronic
1133849865 16:9492637-9492659 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1134202255 16:12208942-12208964 CTTTGTTAGGGGCTGGTAGAAGG + Intronic
1134307628 16:13047311-13047333 TTTTTTAATGGTCTGATTGATGG - Intronic
1134610034 16:15600606-15600628 TTTTTTAAGGGGGGAGGGGATGG + Intronic
1135676331 16:24418015-24418037 TTTTTTGGGGGGTTGGGGGATGG - Intergenic
1137278679 16:46956113-46956135 TTTTTTAAGGGGGTGGTGGTAGG + Exonic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1137781990 16:51105227-51105249 TTTTTAAAGTGGGTGGTGGTAGG + Intergenic
1137797165 16:51231445-51231467 TTTTTTAAGTGCCTGGTGGCAGG + Intergenic
1138230037 16:55329991-55330013 TGTGTTAAGGACCTGGTGGAAGG + Intronic
1138685878 16:58725117-58725139 TTTTTTTTGGAGCTGGGGGATGG + Intronic
1139611194 16:68060164-68060186 TTTTTTAAGGGCTTGGGAGATGG + Intronic
1139835994 16:69838990-69839012 TTTTTTGGGGGGGTGGGGGAAGG + Intronic
1139975201 16:70804434-70804456 GTTTTTAAGGGGATCCTGGAGGG + Intergenic
1140400519 16:74667092-74667114 TTTTTTCCGGGGCGGGTGCAAGG - Intergenic
1140775744 16:78247615-78247637 TTTTATAAGGGGCAGGGGGCAGG - Intronic
1140837966 16:78812719-78812741 TTTTTTAGGGGGTGGGAGGATGG - Intronic
1141209094 16:81959490-81959512 TTCTTTTAGGAGCTTGTGGATGG - Exonic
1141302603 16:82831403-82831425 TTTTTTAAAGTGCTGGGGGTTGG + Intronic
1142029751 16:87832613-87832635 TTTTTTAAGGAGCTGGGGGAAGG - Exonic
1142298166 16:89240831-89240853 TTTTTTGGGGGGCGGGGGGAAGG - Intergenic
1142320392 16:89378843-89378865 TGTTTTAAGGGGTTGATGGGTGG + Intronic
1142567132 17:847688-847710 TCATTTCAGGAGCTGGTGGAGGG - Intronic
1143740116 17:8946359-8946381 TTTCTTAGGTGCCTGGTGGATGG - Intronic
1144393040 17:14813849-14813871 CTTTTCAAGGGGCAGGTCGAGGG - Intergenic
1146120409 17:30188975-30188997 TTTTTTGAGGGGGGTGTGGAGGG + Intergenic
1146171793 17:30640174-30640196 TTTTTTAATGAGCTGGTTAATGG - Intergenic
1146225989 17:31066654-31066676 TTTTTTTTGGGGGTGGGGGATGG - Intergenic
1146438738 17:32876056-32876078 TTTTTCAAGGAGTTAGTGGATGG - Intronic
1147702091 17:42402722-42402744 TGTTTTAAGGGATTGGGGGAGGG - Exonic
1147704042 17:42413787-42413809 TTTTCTAAGGGGCTAGTTGTTGG + Intronic
1147995819 17:44359842-44359864 TTTGGGAAGGGGCTGATGGAGGG + Intronic
1148007088 17:44441717-44441739 TTTTTTGGGGGGCGGGGGGAAGG - Intronic
1148474398 17:47917379-47917401 TTTTTTCAGGGGATGGTGAGGGG + Intronic
1148498984 17:48074662-48074684 TTTATTAAGGAGGTGGTAGAAGG + Intronic
1148934976 17:51157935-51157957 TTTTTTAAGGGCTTGGGGGTTGG - Intronic
1149041120 17:52189509-52189531 GTTTTCCAGGTGCTGGTGGAAGG - Intergenic
1149578609 17:57731375-57731397 TTTTTATAGGGGCTGGGGGTAGG + Intergenic
1149820953 17:59776998-59777020 GTTTTTACAGGGCTGTTGGAGGG - Intronic
1149827034 17:59838067-59838089 GTTTTTAAGGGGTTGTTAGATGG + Intronic
1150130425 17:62666129-62666151 TATTTGAAGGGGATGGTGCACGG - Exonic
1150590395 17:66557221-66557243 TTTTTTAAGGGCCTTGGGGAAGG + Intronic
1150740214 17:67773293-67773315 TTTTGAAAGGGGCTCATGGAGGG + Intergenic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1152656918 17:81524089-81524111 CTTTCTGAGGTGCTGGTGGACGG - Intergenic
1153544473 18:6191990-6192012 TTTTTTGAGGGGGGGGAGGAGGG - Intronic
1154947718 18:21178613-21178635 CTTTTTAATGTTCTGGTGGAAGG + Intergenic
1155087198 18:22470436-22470458 TTTTTTTAGGGGCTGATGGGGGG - Intergenic
1155553677 18:26994588-26994610 TTTTTTGCGGGGCTGGGGGGTGG + Intronic
1156438715 18:37162244-37162266 TTTTTTGTGGGGGTGGGGGAAGG + Intronic
1156472176 18:37384202-37384224 TCATTTATGGGGCTGGGGGAGGG + Intronic
1156641237 18:39101990-39102012 TTTTCTAAGATGCTGGTGTAAGG - Intergenic
1157427258 18:47594572-47594594 TTGTTAAAGGGGCGGGTGGGGGG + Intergenic
1157569213 18:48701172-48701194 TTTTTTCAGGGGCTGCAGAATGG + Intronic
1158403361 18:57140652-57140674 TTTTTCCACGGGCTGGTGCAGGG - Intergenic
1158872632 18:61703147-61703169 GTTTTTAAGGGGATTCTGGAGGG - Intergenic
1159068434 18:63594831-63594853 TTTTTTGGGGGGGTGGGGGATGG - Intronic
1159193789 18:65084899-65084921 TTTTTTAATTGACTGGTGCAAGG - Intergenic
1159263885 18:66053687-66053709 ATTTTTAAGGGGTTGGTGGAAGG + Intergenic
1159669800 18:71209291-71209313 TTTTTGCGGGGGCGGGTGGAAGG + Intergenic
1160249657 18:77190509-77190531 TTTTTTGGGGGGCTGGTGGTTGG + Intergenic
1161707506 19:5829094-5829116 TATTTTTAGTAGCTGGTGGAAGG - Intergenic
1162406585 19:10478478-10478500 TTTTTTAAGTAGCTGGGGGCAGG - Intergenic
1164256056 19:23529257-23529279 TTTTTTTGGGGGGTGGGGGAAGG + Intronic
1164845436 19:31428603-31428625 TTTTTTACAGGGTTGGGGGAGGG + Intergenic
1164929438 19:32164214-32164236 TTTTTTATGGGGGCGGGGGAGGG - Intergenic
1165040861 19:33066483-33066505 TTTTTTCTCGGGCTGATGGAGGG + Intergenic
1165586344 19:36919426-36919448 TTTTTCCAGGGACTGGGGGATGG + Intronic
1166313123 19:41974441-41974463 TTTTTTTGGGGGCTGGGGGCGGG - Intronic
1167132211 19:47594279-47594301 GTTGGTGAGGGGCTGGTGGAAGG - Intergenic
1167316474 19:48766234-48766256 TTTTTTGGGGGGGTGGGGGAGGG + Intergenic
1167987958 19:53334276-53334298 ATTTTCCAGGGGCTGGTGCAGGG - Intronic
1168165922 19:54547755-54547777 TTTTTTGTGGGGCGGGGGGATGG + Intergenic
1168249122 19:55131462-55131484 GTTTTTGAGGGGCTAGGGGACGG - Intergenic
925948309 2:8887260-8887282 TTTTTTGAGGGGGTGGTGGAGGG - Intronic
925964181 2:9048048-9048070 TTTTTCCAGGGGCTGCGGGATGG - Intergenic
926382589 2:12305261-12305283 TATTTGAAGGGGCAGGTGGGTGG - Intergenic
927517762 2:23682067-23682089 TTTTTGGAGGGGATGGTGGTGGG - Intronic
928146638 2:28784433-28784455 TTTTTCAAGGGGGTGTGGGAGGG + Intronic
928718640 2:34093454-34093476 TATTTTAAGGGGCTGGAATATGG + Intergenic
928969756 2:37015522-37015544 TATTTTAGGGGGCGGGTGAAGGG + Intronic
929380913 2:41352308-41352330 TTTTTTAAGGGTCAGGTAGAAGG - Intergenic
929419994 2:41780838-41780860 GTTTTTAAGGGGATCATGGAGGG - Intergenic
929630267 2:43452913-43452935 TTTTTTTGGGGGTGGGTGGAGGG - Intronic
929848190 2:45555073-45555095 ATTTTTAAGGGGATCGTGGAGGG - Intronic
929869894 2:45750289-45750311 TTTTCCCAGGGGCTGGGGGAGGG - Intronic
930117313 2:47729610-47729632 GTTTTTAAGGGGATCATGGAGGG + Intronic
930145053 2:47993459-47993481 TCATTTATGGGGCTGGTGGGAGG + Intergenic
930660158 2:54045246-54045268 GTTTTTAAGGGGATCGTGGAGGG - Intronic
930718330 2:54614337-54614359 TATATTCAGGAGCTGGTGGAAGG - Intronic
930760921 2:55034961-55034983 TTTTTTAAGAGGCTGTTCTAGGG - Intronic
931125140 2:59266856-59266878 TTTTTTTGGGGGCTGGTGAGGGG + Intergenic
931253204 2:60551078-60551100 TTTTTTAAAGGGGTGGTGGTGGG - Intronic
932339388 2:70951591-70951613 TTTTTAAAGGTGGTGGTTGAAGG - Intronic
932433691 2:71690666-71690688 TTTTATAATGGGGTGGAGGATGG - Intergenic
932613824 2:73219377-73219399 TTTTTTTGGGGTCTGGGGGAGGG + Intronic
932623897 2:73283774-73283796 GTTTCTGAGGGGCTGGGGGAGGG - Intronic
932667580 2:73709326-73709348 TTTTGTAAGGTGCTGGTGCAGGG - Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933418463 2:82018472-82018494 TTTTTTGTGGGGCTGGGGGGTGG + Intergenic
933644113 2:84796149-84796171 ATCTTTGAGGGGGTGGTGGAAGG + Intronic
933887285 2:86730256-86730278 TTTTTTTGGGGGGTGGGGGAGGG + Intronic
933922890 2:87066457-87066479 TTTTTTTGGGGGGTGGGGGAGGG - Intergenic
934479252 2:94619706-94619728 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
934520750 2:95018779-95018801 TTTTTTAAGGGGTTTGGGGAAGG + Intergenic
935310085 2:101775050-101775072 TTTTTAAAGGGGCTGAGTGATGG + Intronic
935895837 2:107736560-107736582 TTTTTAAAGGGTCTGATGGTAGG + Intergenic
936064959 2:109323973-109323995 GTTTTCCAGGGGCTGGGGGAAGG - Intronic
937283646 2:120736628-120736650 TTTTTTCAGGGGGTGGAGGGTGG + Intronic
938106288 2:128532630-128532652 TGTTTTCAGGGACTGGGGGATGG + Intergenic
938207091 2:129432990-129433012 TCTTGTAAGAGGATGGTGGATGG + Intergenic
938285213 2:130107906-130107928 TTTTTCCATGGGCTGGGGGAGGG - Intronic
938335863 2:130496449-130496471 TTTTTCCATGGGCTGGGGGAAGG - Intronic
938353960 2:130624215-130624237 TTTTTCCATGGGCTGGGGGAAGG + Intronic
938430386 2:131230987-131231009 TTTTTCCATGGGCTGGGGGAGGG + Intronic
939139749 2:138340126-138340148 TTTTTTAAGGGGTGGGGGGCAGG - Intergenic
939367516 2:141252192-141252214 TTTTTTTAGGGGGTGGGGGGTGG - Intronic
944074307 2:195710817-195710839 ATTTTGAAGGGGCTTGTGGAAGG + Intronic
944191615 2:197009973-197009995 TTTTTAAAGGGGTTGGAGGCAGG - Intronic
944734490 2:202549901-202549923 TCTTTTTTGGGGGTGGTGGAGGG + Intronic
944755649 2:202759363-202759385 TTTTTTGTGGGGATGGTGGAAGG - Intronic
944863841 2:203841131-203841153 TTTTTTAATGGGCTAATTGAAGG + Intergenic
945160695 2:206887388-206887410 TTTTTTCAGGGGCTCATGGATGG - Intergenic
945185345 2:207134248-207134270 TTTTTTATGGGGGTAGGGGAAGG - Intronic
945374278 2:209061125-209061147 GATTTTAAGGGGATGGTGCAGGG + Intergenic
945929656 2:215842169-215842191 TTTCTGAATGGGCTGGTGGCAGG + Intergenic
946728714 2:222688052-222688074 TTTTTGAAGGGGGAGGTGGAAGG - Intronic
946951273 2:224877839-224877861 TTATTTAAGGGGGTGGTTGTTGG + Intronic
947308851 2:228778282-228778304 GTTTTTAAGGGGATCATGGAAGG - Intergenic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
947938320 2:234026203-234026225 GTTTTGAAGGGGCTGGAGGGTGG - Intergenic
947945583 2:234099143-234099165 TTTTTTAGTGGGGTGGTGGGAGG - Intergenic
948157795 2:235798479-235798501 TTTTTTAAGGACATGGTGGAAGG + Intronic
949013039 2:241692761-241692783 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1169260032 20:4130753-4130775 TGTTTTCAGAGGCTGGGGGAAGG + Intronic
1169669462 20:8080102-8080124 TTTTGTAAGTGGTGGGTGGAAGG + Intergenic
1170809969 20:19666499-19666521 TTTTTTTGGGGGGTGGGGGATGG - Intronic
1173348062 20:42219168-42219190 TTCTTTAGGAGGCTGGTGCAGGG - Intronic
1173620192 20:44430481-44430503 TTTCTCAAAGGCCTGGTGGATGG - Exonic
1173691394 20:44963971-44963993 TTGTCTAAGGCCCTGGTGGAAGG - Intergenic
1174374891 20:50119955-50119977 TTTTTTAAATGGCTGGGGGAGGG - Intronic
1174899048 20:54479370-54479392 CTATTTGAGGGGCTGGGGGAAGG + Intronic
1175267433 20:57710864-57710886 ATTTTTAAGAGGCTGGAGGTGGG - Intronic
1177486958 21:21770861-21770883 TTTTTTCAGAGGTTGGTGCAAGG + Intergenic
1177907631 21:26991541-26991563 TTTTTTTGGGGGGTGGTGGGGGG + Intergenic
1178235639 21:30837951-30837973 TTTTTTAATTGGCTGTTGGCTGG - Intergenic
1180484030 22:15778930-15778952 TTTTTTGGGGGGGTGGGGGATGG + Intergenic
1181791378 22:25269572-25269594 TTTTTTACGGGGATCATGGAGGG + Intergenic
1181827072 22:25525683-25525705 TTTTTTAAGGGGATCATGGAGGG + Intergenic
1182104954 22:27682653-27682675 ATTTTCCAGGGGCTGGTGGCCGG - Intergenic
1182296723 22:29314624-29314646 TTTCTACGGGGGCTGGTGGAGGG - Intronic
1182844806 22:33421550-33421572 TTTTTTAAGAGGCAGACGGAGGG - Intronic
1183107906 22:35627872-35627894 TTTTTCAAGGGAATGGTGGGAGG - Intronic
1183215078 22:36474200-36474222 TGTTTACAGGGGCTGGGGGAGGG - Intronic
1183756909 22:39775901-39775923 CTTTTTAAGGGGTTGGGGGCAGG + Intronic
1184467714 22:44678621-44678643 TTCTTTAAGCCGCTGCTGGAAGG + Intronic
1184502385 22:44881931-44881953 TTTTTTACGAGCCGGGTGGAGGG - Exonic
1185054851 22:48574281-48574303 TGTTTTCGGGGGCAGGTGGAGGG + Intronic
949606211 3:5657093-5657115 TTTTTAAAGGGGATCATGGAGGG + Intergenic
949981399 3:9504019-9504041 TTTTTTAAGAGATTGGGGGAGGG - Intronic
949991587 3:9583625-9583647 GCTTTTAAGGGGATCGTGGAAGG + Intergenic
950490068 3:13299227-13299249 TTTTTTGAGGGGTGGGGGGATGG - Intergenic
950920331 3:16687688-16687710 TTTTTAAAGGGTCTGTAGGAGGG - Intergenic
951071556 3:18334768-18334790 GTTTTCCAGGGGCTGGAGGAAGG - Intronic
951562205 3:23980336-23980358 TTTTTTTAGGGGTTGGGGGAGGG + Exonic
951997633 3:28748766-28748788 TTCTCTAAGGAGCTGGTAGATGG + Intergenic
952143945 3:30511325-30511347 TTTTTTTGGGGGGTGGGGGACGG + Intergenic
952271726 3:31839460-31839482 TCTTTTTAGGGGGTGGTGGGTGG - Intronic
952291762 3:32023571-32023593 TTCTTTTAGGGGCTTGTGGGTGG - Intronic
952381031 3:32805579-32805601 TTTTTTGGGGGGGTGGGGGATGG + Intergenic
952518901 3:34134823-34134845 TTTTTTATGTTGTTGGTGGAAGG - Intergenic
952594934 3:35005789-35005811 ACTTTTAAGGGGATTGTGGAGGG + Intergenic
952693133 3:36233598-36233620 GCTTTTAAGGGGATGATGGAGGG - Intergenic
952861274 3:37814557-37814579 TTTTTTGGGGGGGTGGGGGATGG - Intronic
953168770 3:40488657-40488679 TTTTTTTAGGGGGTGGGGGGTGG + Exonic
953332679 3:42066859-42066881 CTTTTTCAGGGGCTGGGGGGAGG + Intronic
953344354 3:42162658-42162680 TATCTTAGGGGTCTGGTGGAGGG + Intronic
953716251 3:45319257-45319279 TTTTTCCTGGGGCTGGGGGAGGG - Intergenic
954593777 3:51806597-51806619 TTTTTTAATGGAGTGCTGGATGG - Intergenic
954966382 3:54614844-54614866 TTTTTTTGGGGAGTGGTGGAGGG - Intronic
955062727 3:55507134-55507156 GTTGTTAAGGGGCAGCTGGAGGG + Intergenic
955278965 3:57575288-57575310 TTTTTGAAGGGAGAGGTGGAAGG - Intronic
955736864 3:62047843-62047865 GTTTTTAAAAGGCTGGGGGAGGG - Intronic
956174268 3:66458411-66458433 TGTTTTAAGGGGCTGGGTGTGGG + Intronic
957766277 3:84629173-84629195 TTTTTTGGGGGGGTGGGGGATGG + Intergenic
957774684 3:84741858-84741880 TTTTCTAAGGGACTGGTTGCTGG + Intergenic
957859492 3:85926256-85926278 TTTTTTTGGGGGCTGGTGTGGGG + Intronic
958514991 3:95102768-95102790 ATTTTTAAGGTGCTTGTTGAGGG + Intergenic
960744357 3:120870251-120870273 TTTTTTAATGGGCTTGTGGCAGG - Intergenic
962095490 3:132288312-132288334 GTTTTTAAGGGGATCATGGAGGG + Intergenic
962573605 3:136735780-136735802 TTTTTTCTGGGGGTGGTGGGAGG + Intronic
965090873 3:164161564-164161586 TTTTTGAAGTGGCTGGTGCCAGG + Intergenic
965754923 3:172015945-172015967 TTTTGAAAGGGGGTTGTGGATGG + Intergenic
966401804 3:179555220-179555242 TTTTTTAAGCAGGAGGTGGAGGG - Intergenic
966742713 3:183249324-183249346 TTTTCACAGGGGCTGTTGGAGGG + Intronic
967131798 3:186477313-186477335 TTTTTCAAAGTGCTGCTGGAGGG + Intergenic
967969547 3:194988807-194988829 TTCTTTGTGGGGCTGCTGGAAGG + Intergenic
968721546 4:2210276-2210298 TTTTTTAAGGGGATGATTGTGGG + Intronic
968939173 4:3629156-3629178 GTTTTTAAGGGGATCATGGAAGG - Intergenic
972796161 4:42421940-42421962 TTTTTGGAGGGGGTGGTGTAAGG + Intronic
973982857 4:56320820-56320842 TATTTTATGAAGCTGGTGGAAGG - Intronic
974140728 4:57883207-57883229 TTTTTACAGGGGAGGGTGGATGG + Intergenic
974334157 4:60518382-60518404 TATTTTGAGGAGCTGGTGAATGG + Intergenic
974480538 4:62437581-62437603 GTTTTTAAGGGGATTATGGAGGG + Intergenic
975021581 4:69497334-69497356 GTTTTTAAGGGGTTAATGGAGGG - Intronic
975630839 4:76400592-76400614 TTTTTTGGGGGGGTGGTGGGTGG - Intronic
975650916 4:76592056-76592078 ATTTTTTAGGGGGTGGTGGAAGG + Intronic
975826590 4:78326252-78326274 CTTATTAAGGGGCTGTGGGAAGG + Intronic
976995729 4:91431469-91431491 TTTTTTCGGGGGGCGGTGGATGG + Intronic
977077528 4:92474962-92474984 TTTTTTGGGGGGGGGGTGGAGGG + Intronic
977258137 4:94762866-94762888 TTTTTTGCGGGGCTGGGGGCTGG + Intronic
977890746 4:102308499-102308521 ATCTTAAAGGGGCTGGTGTAAGG + Intronic
978579176 4:110215640-110215662 GTTTTTAAGGGGATCGTAGAGGG + Intergenic
978765716 4:112403041-112403063 CTTTTTTAGGGGGTGGGGGAGGG + Intronic
979006690 4:115307830-115307852 ATTTTTAAGGTGATGGAGGATGG - Intergenic
981625119 4:146746856-146746878 TCTTTTTAGGGGGTGGAGGAGGG - Intronic
982239988 4:153290211-153290233 TTTTTCAAAGGGCTGGCAGAAGG - Intronic
982346152 4:154362375-154362397 ATTTTTAAGAGGCTGTAGGAAGG + Intronic
982762103 4:159297234-159297256 TTTTTTTGGGGGTTGGGGGAAGG - Intronic
983451564 4:167918212-167918234 GTTTTTAAGGGGATCATGGAGGG + Intergenic
983504553 4:168538955-168538977 CCTTTTTAGGGGCTGGGGGAGGG - Intronic
984870309 4:184319179-184319201 TTTTTTATGGTGCTGATAGAAGG - Intergenic
985874905 5:2587114-2587136 TCCTTTCAGGGGCTGCTGGAGGG + Intergenic
986524663 5:8660947-8660969 ATTTTGTAGGGGTTGGTGGAAGG - Intergenic
986769649 5:10960639-10960661 TGTTGTCAGGGGCTGGGGGAAGG + Intergenic
987767890 5:22258443-22258465 TCTTTTAAGAGGTTGGTGGTGGG - Intronic
988391208 5:30634594-30634616 GTTTTTTAGGGGCTTGAGGAAGG - Intergenic
988683098 5:33502615-33502637 TTTGTGAAGTGGCAGGTGGATGG + Intergenic
989063626 5:37435965-37435987 TTTGATAAGGGGGTGGTGGTGGG + Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
990489893 5:56294356-56294378 TATTTTCAGGGGCTGCTGCATGG + Intergenic
990664727 5:58059465-58059487 TTTTTCCAGGGGCTGGTGGTGGG + Intergenic
991264548 5:64701528-64701550 TTTTAGAAGGGGCTGGGGGAAGG + Intronic
991341485 5:65615511-65615533 TTTTTTAAGAGCCAGGAGGAAGG - Intronic
992315681 5:75551394-75551416 TTTTTTAAGAGGTTGGGGGGTGG - Intronic
992349852 5:75917236-75917258 TTTTTTAAAGGTTTGGTGGCAGG - Intergenic
992389418 5:76316593-76316615 TTTATTTAGGGGCTGGAGGGAGG + Intronic
992757984 5:79926898-79926920 TTTTTTAAGGGGGAGGGGTAGGG - Intergenic
992778755 5:80109851-80109873 GTTTTATAGGGGCTGGGGGAGGG - Intergenic
992789516 5:80201092-80201114 TTTTGTGGGGGGGTGGTGGATGG - Intronic
993092443 5:83442581-83442603 TTTTTGAGGGGGTTGTTGGAGGG + Intergenic
993841140 5:92880250-92880272 TTTTTAAAGGGGTTGGGGGATGG + Intergenic
994549426 5:101211428-101211450 TTTGTTAGGGGGCTGCTTGACGG + Intergenic
996276185 5:121668725-121668747 GTTTTTAAGGGGATCGTGGAGGG + Intergenic
996448240 5:123583839-123583861 TTTTTTAATTAGCTGGTGGCTGG - Intronic
996552864 5:124748030-124748052 TTTTTTAAGGAGATGGCGAATGG + Intronic
996677153 5:126189380-126189402 ATTTTTAAGTGGCTGATTGAAGG + Intergenic
996704495 5:126483625-126483647 TTTTTTAAGGGGGTGGGGTGAGG - Intronic
997045475 5:130311762-130311784 ATTTTTAAGGTATTGGTGGATGG - Intergenic
998020629 5:138766893-138766915 TTTTTTAGGGGGCAGAGGGAAGG + Intronic
998677236 5:144423467-144423489 TTTCTGAAAGGGCTGGGGGATGG - Intronic
998722796 5:144974022-144974044 TTTCTTTAGGGCATGGTGGAAGG - Intergenic
999370262 5:151050844-151050866 TTTTTGTTGGGGCTGGGGGAGGG + Intronic
1000393978 5:160753575-160753597 ATTCTTAAGGGGCTGCAGGAGGG + Intronic
1001480973 5:172089084-172089106 TTGTTTAAGGGACTGGTGGAGGG - Intronic
1001788398 5:174433557-174433579 TTATTTAACGGGCTGGGGGCAGG - Intergenic
1002521304 5:179794490-179794512 CTTTTTAGGGGGCTGGAGGAAGG - Intronic
1003539172 6:7003067-7003089 TTTTTAAAAGGCCTGGTGGCTGG + Intergenic
1003804759 6:9714477-9714499 TTTTTTACGGGGGTGGGGCAGGG + Intronic
1004924591 6:20404076-20404098 TTTTCTAGGGGGCGGATGGATGG + Intronic
1006124907 6:31831294-31831316 TTTTTTGGGGGGGTGGTGGGTGG + Intergenic
1006303481 6:33206245-33206267 TTTTCTAGGGGACTGGTGGTTGG + Intronic
1006948449 6:37801222-37801244 TTGTTTAAGGAGTCGGTGGAGGG - Intergenic
1006973027 6:38066593-38066615 TTTTGTTTGGGGCTTGTGGAAGG + Intronic
1007006455 6:38368337-38368359 TTTTTTAGGGGGCGGGGGAATGG + Intronic
1007731942 6:43952743-43952765 ATTTTGTAGGGGCTGGTGGTAGG - Intergenic
1008514445 6:52306480-52306502 TTTTTTAAGGTGTTGGGGGTAGG - Intergenic
1009327953 6:62377436-62377458 TTTTTTAATGTGCTGGTGGGTGG - Intergenic
1010383668 6:75253105-75253127 TATTTTGAGGGGAGGGTGGAGGG - Exonic
1010620026 6:78062605-78062627 TTTTTCAAGGGACTCATGGAAGG - Intergenic
1011491595 6:87898904-87898926 TTTTTTAGGGGGGAGGGGGACGG + Intergenic
1011870971 6:91892221-91892243 ATGTTTAAGGGGATTGTGGAGGG - Intergenic
1013023837 6:106249264-106249286 ATTTTTCAGGGGCTGGGGCAAGG - Intronic
1013794390 6:113869406-113869428 TTATGTGAGGGACTGGTGGAAGG + Intergenic
1015233753 6:130947019-130947041 TAATTTAAGGGGCTGGGGGGGGG - Intronic
1016047794 6:139498108-139498130 TTTTTTAAGAAGCTGGGGAATGG - Intergenic
1017358695 6:153541317-153541339 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1018748689 6:166782467-166782489 TTGTTTAAGAGTCTGGTGCATGG - Intronic
1019553194 7:1614167-1614189 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1019874530 7:3797742-3797764 TTTTTTAAATGGCTAGTGAATGG + Intronic
1020021565 7:4872455-4872477 TTTTGTCAGGGGCTGGGGAACGG - Intronic
1020085221 7:5306753-5306775 TTATTTCAGGGGCTGGAGTAGGG - Exonic
1020950091 7:14664544-14664566 TTTTTTAAAGGGCATGTGTAAGG - Intronic
1021438942 7:20655479-20655501 TTTTTTGGGGGGCTGGGGGGAGG - Intronic
1021865357 7:24951073-24951095 TTTTTGTTGGGGCTGGTGGTGGG - Intronic
1021963249 7:25893393-25893415 TTTTTTGCGGGGTGGGTGGAGGG - Intergenic
1022486486 7:30782725-30782747 TATTTTAAGGAGCTGGCTGATGG + Intronic
1022982564 7:35618212-35618234 TTTCTTAAGAAGCTGCTGGACGG - Intergenic
1023031490 7:36093763-36093785 TTTTTTCACGGACTGGTGGGTGG - Intergenic
1023644843 7:42299972-42299994 TTTTTCACAGGGCTGGTGGTCGG - Intergenic
1026286037 7:68963581-68963603 TTTTATAAGGGGATCCTGGAGGG + Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1027251038 7:76398857-76398879 GTGTTTAAGGGGCAGGAGGATGG + Intronic
1027288200 7:76672315-76672337 TTTTTTGAGGGGGTGAGGGATGG - Intergenic
1027367915 7:77477761-77477783 TTTTTGGGGGGGCAGGTGGATGG + Intergenic
1028489558 7:91395686-91395708 TTTTTTAATGGGCTTTTGTAAGG + Intergenic
1029900544 7:104034763-104034785 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1032742004 7:134748705-134748727 TTTTTTGGGGGGCGGGGGGATGG - Intronic
1032984103 7:137317755-137317777 CTTTTTCAGGGGGTGGGGGAAGG + Intronic
1033180561 7:139173609-139173631 CTTTTTAAGGAGATGGTGGATGG - Intronic
1033638258 7:143233775-143233797 TTTTTTAATGAGCTGGTGATTGG + Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034442830 7:151095612-151095634 TTTTTCCAGGCACTGGTGGATGG + Intronic
1035616528 8:1006218-1006240 CTTTTTCAGGGGTTGGGGGATGG - Intergenic
1036187493 8:6636792-6636814 TTTTTTTGGGGGGTGGTGGGTGG - Intronic
1036560262 8:9895802-9895824 ATTTTCAAGGGGCTGGGGGAAGG + Intergenic
1037373972 8:18208889-18208911 TTGTTTTAGGGTCTGGCGGAAGG - Intronic
1037592797 8:20327662-20327684 TTTCTTAAGGCGCTTGGGGAAGG + Intergenic
1037787442 8:21911293-21911315 GCTTTTGAGGAGCTGGTGGAGGG - Intronic
1038296338 8:26293657-26293679 TTTTTCCAGGAGCTGGAGGAGGG + Exonic
1040974052 8:53170332-53170354 ATTTTTAAGGGGGTCATGGATGG - Intergenic
1041936763 8:63340612-63340634 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1041946953 8:63455516-63455538 TATTTTAAGTGGATGGTGGGAGG + Intergenic
1043690670 8:83146930-83146952 TTTTTCAAGGGGGTGGAGGATGG - Intergenic
1044798395 8:95928032-95928054 TGTGGTAGGGGGCTGGTGGAGGG - Intergenic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1046470138 8:114661912-114661934 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1048348692 8:133598166-133598188 TTTTTTGGGGGGCGGGGGGACGG - Intergenic
1048352606 8:133628082-133628104 TTTTTTCGGGGGGTGGTGGGGGG + Intergenic
1048374541 8:133811431-133811453 TATTTTAAGGGAATGGGGGAAGG + Intergenic
1048688002 8:136925894-136925916 TTCTTTGAGGAGCTGGAGGAGGG - Intergenic
1048910535 8:139130474-139130496 GTATTTAAGGGCCTGGTGGCTGG + Intergenic
1049602386 8:143513970-143513992 TTCAGAAAGGGGCTGGTGGAGGG - Intronic
1049864109 8:144922504-144922526 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1050286323 9:4106107-4106129 TTGTCTAAGGTGTTGGTGGAAGG - Intronic
1050318072 9:4423448-4423470 TTTTCTAAAGGTCTGGGGGAGGG - Intergenic
1050382870 9:5049159-5049181 CTCTTTAAGAGGCTGGTGTATGG - Intronic
1051381351 9:16462212-16462234 TTTTTTCTTTGGCTGGTGGATGG - Intronic
1051387263 9:16522547-16522569 TTTTTTACAGGGATGGGGGAGGG + Intronic
1051508276 9:17848746-17848768 TTTTCCCAGGGGCTGGAGGAAGG - Intergenic
1052732625 9:32307470-32307492 ATTTTTAAGGGGATTGTGGAGGG - Intergenic
1053678577 9:40463859-40463881 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1053928562 9:43092213-43092235 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054285147 9:63161083-63161105 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054291655 9:63299397-63299419 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054389671 9:64603940-64603962 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054506041 9:65912436-65912458 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054836017 9:69675115-69675137 TTTTTCATGGGGGTGGGGGAGGG - Intergenic
1054853721 9:69875217-69875239 TTTTTTAAGGGGGTGAGGGAAGG + Intronic
1054953497 9:70881374-70881396 TTTTGTATGGGGGTGGTGGTAGG - Intronic
1054954868 9:70898125-70898147 TTTTTTTGGTGGCTGGGGGACGG + Intronic
1056579287 9:87878724-87878746 GTTTTTAAGGAGATTGTGGAGGG - Intergenic
1057594032 9:96399331-96399353 CTTTTTTGGGGGATGGTGGAGGG + Intronic
1058664310 9:107296256-107296278 ATTTTTAAGGTGGTGGGGGAAGG - Intronic
1058683392 9:107459578-107459600 TTTTTAAATGGGCGGTTGGAAGG - Intergenic
1058816887 9:108692464-108692486 TATGTGAAGGGACTGGTGGAGGG - Intergenic
1059207588 9:112481114-112481136 TTTTTTGGGCGGCTGGGGGAGGG + Intronic
1059417095 9:114168888-114168910 TTTTTAGAGGAGCTGGTGGTAGG - Exonic
1059555092 9:115272677-115272699 TTTTTTTTGGGGGGGGTGGATGG + Intronic
1061636196 9:131910532-131910554 TTTTTTAAAGGGCTACTGAAGGG + Intronic
1061704822 9:132444931-132444953 TGTTGCTAGGGGCTGGTGGAGGG - Intronic
1062308913 9:135925378-135925400 TTTTTTGGGGGGGTGGGGGATGG + Intergenic
1186225632 X:7396134-7396156 GCTTTTAAGGGGATTGTGGAGGG + Intergenic
1186316397 X:8375154-8375176 AGTTTTAAGGGGCTCTTGGAGGG - Intergenic
1186571809 X:10723026-10723048 TAATTTTAGGTGCTGGTGGAGGG + Intronic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1187811882 X:23188253-23188275 TTTTTTAAGGGACTCCTGAAAGG + Intergenic
1188811189 X:34656446-34656468 TTTTTTAACGGGGGTGTGGAAGG + Intronic
1188927480 X:36062686-36062708 TGTTTTCAGGGGCTGGGGGTGGG + Intronic
1189057587 X:37714588-37714610 TATTTTAAGTGGCTTCTGGAAGG - Intronic
1189420707 X:40855248-40855270 TTTTTTTAGGGGCAGGGGCAGGG + Intergenic
1189487790 X:41446259-41446281 TGTTTTAGGAGACTGGTGGAGGG - Intergenic
1190624214 X:52320785-52320807 TTTTTTATGGGGGTGGGGGAGGG + Intergenic
1191211359 X:57888765-57888787 TATTTTAGGGGACTGTTGGAAGG - Intergenic
1192487798 X:71545283-71545305 TTTTTTAAGGGGTTGGGGTGGGG - Intronic
1193645072 X:84057670-84057692 TTTATTAAGGGGCTGGGAGATGG + Intergenic
1193667319 X:84337920-84337942 TTTTTTAAGGGGCTGGTGGAGGG - Intronic
1194555221 X:95350082-95350104 TTTTTTTGGGGGGTGGGGGAGGG - Intergenic
1194763646 X:97824005-97824027 TTTTTTAAGGGGATGGGGGAGGG - Intergenic
1194891690 X:99386378-99386400 GGTTTTCAGGGGCTGGGGGAAGG - Intergenic
1195390587 X:104358071-104358093 GTTTTTAAGCGGATTGTGGAGGG + Intergenic
1195416031 X:104620341-104620363 TTTTTTAAAGAGATGGTGGCTGG + Intronic
1195527685 X:105910678-105910700 GTTTTTAAGGGGATTGTAGAGGG + Intronic
1195539618 X:106047786-106047808 TTATTTCAGGGGCTAGTGCAAGG - Intergenic
1195882880 X:109611009-109611031 TTTTTCCAGGTGCTGGTGGTAGG - Intergenic
1195996078 X:110732773-110732795 TTTTTTGGGGGGCAGGGGGAGGG + Intronic
1197541235 X:127764493-127764515 GTTTTTAAGGGGCAGGTGTGAGG - Intergenic
1197859182 X:130951013-130951035 CTTTTTGAGGGGGTGGGGGAAGG + Intergenic
1200176513 X:154120932-154120954 TTTTTTAGGGGGAGGGGGGAAGG + Intergenic
1201059325 Y:10031167-10031189 TTTTTTTAGGGGCACGTGTAAGG - Intergenic
1201595235 Y:15660761-15660783 GCTTTTAAGGGGATCGTGGAAGG + Intergenic